Closed. This question needs details or clarity. It is not currently accepting answers.
Want to improve this question? Add details and clarify the problem by editing this post.
Closed 1 year ago.
Improve this question
I have a long text file with the following format:
>foo_bar
TATGTTCTGCAACTGTATAATGGTATAAAAACATTGCAAAATGTAATGAAACTTGTTATTTTGTGAAATACATTCTATAAATATCACTATTTCATGAAAA
ATATTGAAAATCATTTATTTTCGACAAGTAGAACCATAGGTTCTGTAATTGTAAATAGTTCTGCAAACTTAACCTGTTTTGCAGAAGAATATGTTTTCAC
TAGTTAACTTGTAGAATGTTTAGGATTGTTAAAATTTTTAACAAAATAAGATTTTATAGAACATGATTTGCAAAATAACACATTTTGCAATATTTTTATA
CCATATATAGTTGCAGAACATATGGGGACTACGGGCAGCCGGTAAATATGTGGACTACATGGAACTTGTTCAGATACATCTGGAGCAAAGAGCCACCGCT
CTAAATTATCTCTTCTCATTTCCAGTATTATATCTCTCATGCTAAATTATCTCTACAAATCATGACCTCTCTTAGCAATCTCCCTGAGCATCTCCGTAGG
GAGCAGATATTCACCCGTCTTCCGATGAAAGACCTAATGGTCCTCGCATCTGCAAGTCATGTCTTGCGTTAATCTTTCTCTCTCTTTTTGTGGAATCCCA
TCTCTCCTCTTATCAACTAAACCAGATACAGTTTGCACCAACTTTCTTCACTCCCCTGTTACATGAGAAGGCCAGACTTAGGTAGCTTCTGAATCAGAAC
CCGGTCATTCCAAGCATGGGATTTCTTGTTGATCTCTTGTTTTTATGTAATAGTGATCATTTGATATCTGGTGTTGATGGGAATTCAGATGTATGGGACT
TTGTTTATTGTTGATGTGGAATTCTTATATTTTACTGTGTACTATAAAATTTTAGTGATACCTACTATCTATTGTATAAATTGATTAATTGATGTTCTTA
>bar_foo
TATGTTCTGCAACTGTATAATGGTATAAAAACATTGCAAAATGTAATGAAACTTGTTATTTTGTGAAATACATTCTATAAATATCACTATTTCATGAAAA
ATATTGAAAATCATTTATTTTCGACAAGTAGAACCATAGGTTCTGTAATTGTAAATAGTTCTGCAAACTTAACCTGTTTTGCAGAAGAATATGTTTTCAC
TAGTTAACTTGTAGAATGTTTAGGATTGTTAAAATTTTTAACAAAATAAGATTTTATAGAACATGATTTGCAAAATAACACATTTTGCAATATTTTTATA
CCATATATAGTTGCAGAACATATGGGGACTACGGTACTACGGTAAATATGTGGACTACATGGAACTTGTTCAGATACATCTGGAGCAAAGAGCCACCGCT
CTAAATTATCTCTTCTCATTTCCAGCTGCATATCTCTCATGCTAAATTATCTCTACAAATCATGACCTCTCTTAGCAATCTCCCTGAGCATCTCCGTAGG
GAGCAGATATTCACCCGTCTTCCGATGAAAGACCTAATGGTCCTCGCATCTGCAAGTCATGTCTTGCGTTAATCTTTCTCTCTCTTTTTGTGGAATCCCA
TCTCTCCTCTTATCAACTAAACCAGATACAGTTTGCACCAACTTTCTTCACTCCCCTGTTACATGAGAAGGCCAGACTTAGGTAGCTTCTGAATCAGAAC
CCGGTCATTCCAAGCATGGGATTTCTTGTTGATCTCTTGTTTTTATGTAATAGTGATCATTTGATATCTGGTGTTGATGGGAATTCAGATGTATGGGACT
TTGTTTATTGTTGATGTGGAATTCTTATATTTTACTGTGTACTATAAAATTTTAGTGATACCTACTATCTATTGTATAAATTGATTAATTGATGTTCTTA
I.e., there is a header line which begins with a ">", and then an arbitrary number of lines with no more than 100 letters in them. I would like to find the positions within the non-header lines that match either "GCAGC" or "GCTGC". Overlapping match sites would both get recorded individually.
An example output would be a three column text file where the first column contained the header line for that block of text minus the ">", the second column contained the start position of a pattern match (i.e., the number of characters into the text block, excluding line-break characters), and the third column recorded which of the two patterns were matched. E.g.:
foo_bar 109 GCAGC
bar_foo 58289 GCTGC
Not sure how complex this task is, and in particular whether there is a memory-efficient way to perform this operation in a streaming fashion. awk or sed seem like two utilities which might work, but the required command is beyond my limited understanding of the programs.
A tiny tweak on yesterdays answer:
sub(/^>/,"") {
hdr = $0
next
}
{
while ( match($0,/GC[AT]GC/) ) {
print hdr, RSTART, substr($0,RSTART,RLENGTH)
$0 = substr($0,1,RSTART-1) " " substr($0,RSTART+1)
}
}
Please get the book Effective AWK Programming, 5th Edition, by Arnold Robbins to learn the basics of awk.
Related
Closed. This question needs to be more focused. It is not currently accepting answers.
Want to improve this question? Update the question so it focuses on one problem only by editing this post.
Closed 6 months ago.
Improve this question
I have a list of product codes grouped in 2 or 3 lines. I need to return the group where codes are not same (or consecutive)
9003103
9003103
9003978
9003979
9003763
9003728
9003543
9003543
9003543
In this case, only the third group should be returned:
9003763
9003728
I would harness GNU AWK for this task following way, let file.txt content be
9003103
9003103
9003978
9003979
9003763
9003728
9003543
9003543
9003543
then
awk 'BEGIN{RS=""}{diff=$NF-$1;diff=diff>0?diff:-diff}diff>NF' file.txt
gives output
9003763
9003728
Explanation: I set RS to empty string to provoke paragraph mode, thus every block is treated as single line, then for each block I compute absolute of difference between first and last field, if difference is bigger than number of field block is printed.
(tested in GNU Awk 5.0.1)
Closed. This question does not meet Stack Overflow guidelines. It is not currently accepting answers.
This question does not appear to be about programming within the scope defined in the help center.
Closed 2 years ago.
Improve this question
Suppose I have a file similar to the following:
hello
hello
hi
hi
hello
hey
I would like to find the indices of every unique line and using a comma as the indices separator. So ideally, the output would be like:
hello 1,2,5
hi 3,4
hey 6
What has been done in getting the value of lines by using the following codes,
{ arr[$0]++ }
END { for (i in arr) {
print i
}
}
the result is,
hey
hi
hello
Try using this script
{
words[$0] = words[$0] == "" ? FNR : words[$0] "," FNR # appends the line, sorting for the word
}
END { # once we are done reading the file
for (w in words) # for each word, the sorting order depends on awk internal variables.
{
print w, words[w] # prints the desired output
}
}
Please see Controlling Array Traversal for more details on how the words are going to be printed out and how to control it. For more details on FNR see What are NR and FNR.
Closed. This question needs to be more focused. It is not currently accepting answers.
Want to improve this question? Update the question so it focuses on one problem only by editing this post.
Closed 3 years ago.
Improve this question
I am looking for some suggestions on how I can read text files by every n-th file in Raku/perl6.
In bioinformatics research, sometimes we need to parse text files in a somewhat less than straightforward manner. Such as Fastq files, which store data in groups of 4 lines at a time. Even more, these Fastq files come in pairs. So if we need to parse such files, we may need to do something like reading 4 lines from the first Fastq file, and reading 4 lines from the second Fastq file, then read the next 4 lines from the first Fastq file, and then read the next 4 lines from the second fastq file, ......
May I have some suggestions regarding what is the best way to approach this problem? Raku's "IO.lines" approach seems to be able to handle each line one at a time. but not sure how to handle every n-th line
An example fastq file pair: https://github.com/wtwt5237/perl6-for-bioinformatics/tree/master/Come%20on%2C%20sister/fastq
What we tried before with "IO.lines": https://github.com/wtwt5237/perl6-for-bioinformatics/blob/master/Come%20on%2C%20sister/script/benchmark2.p6
Reading 4 lines at a time from 2 files and processing them into a single thing, can be easily done with zip and batch:
my #filenames = <file1 file2>;
for zip #filenames.map: *.IO.lines.batch(4) {
# expect ((a,b,c,d),(e,f,g,h))
}
This will keep producing until at least one of the files is fully handled. An alternate for batch is rotor: this will keep going while both files fill up 4 lines completely. Other ways of finishing the loop are with also specifying the :partial flag with rotor, and using roundrobin instead of zip. YMMV.
You can use the lines method. Raku Sequences are lazy. This means that iterating over an expression like "somefile".IO.lines will only ever read one line into memory, never the whole file. In order to do the latter you would need to assign the Sequence to an Array.
The pairs method helps you getting the index of the lines. In combination with the divisible by operator %% we can write
"somefile".IO.lines.pairs.grep({ .key && .key %% 4 }).map({ .value })
in order to get a sequence of every 4th line in a file.
Closed. This question needs to be more focused. It is not currently accepting answers.
Want to improve this question? Update the question so it focuses on one problem only by editing this post.
Closed 4 years ago.
Improve this question
In the following example, I need to readjust the content within the 2nd set of quotes on line 5, up to, but not beyond the decimal point.
The contents of the quotes vary so everything between " and . must be captured and cannot be matched by using a search string based on any contents between.
It is also possible that in the future the line number may change, however, the line can always be found by searching for "Item".
The process should utilize awk, grep, cat, sed or a combination of them due to the limitations of the proprietary environment/OS. I have searched around but wasn't able to find anything that would work as desired.
filename: data.json
{
"Brand": "Marketside",
"Price": "3.97",
"SKU": "48319448",
"Item": "12-ct_Large_Grade_A(Brown_Organic).48319448",
}
An Example of a successful output would be:
12-ct_Large_Grade_A(Brown_Organic)
The requirement to rely exclusively on line-oriented tools to manipulate JSON seems extremely misdirected. When manipulating structured formats, use tools which understand the structured format.
jq '.Item|split(".")[0]' data.json
to extract up to the first dot; or
jq '.Item|sub("[.][^.]*$";"")' data.json
to discard the text from the last dot until the end of the field.
(jq doesn't like the superfluous last comma after the Item in your pseudo-JSON, though.)
There is no doubt in anyone's mind that your acute problem as stated can be solved with a simple Awk or sed script. What happens then - what already happened here - is that you discover additional requirements which were not obvious from the toy example you posted. A proper, portable solution copes with JSON samples with strings with embedded commas and escaped double quotes, and continues to work when the superficial JSON format changes because a component somewhere upstream is updated to put all the JSON on a single line or whatever.
Here is an awk:
awk -F'.' '/Item/{split(substr($0,1,L=length($0)-length($NF)-1),a,"\"");print a[4]}'
12.ct.Large.Grade.A(Brown_Organic)
It search for Item and then print from " to latest .
Split the string by .
Find the length of latest part after the split length($NF)
Extract this lengt from total to find position of latest . length($0)-length($NF)
Then split the the first part by " and print the 4th part.
Closed. This question needs to be more focused. It is not currently accepting answers.
Want to improve this question? Update the question so it focuses on one problem only by editing this post.
Closed 8 years ago.
Improve this question
I need to pull the first word from a variable in my batch script to another variable.
ex
if %hello% had "apples are awesome" in it and was pulled and put into %hi%
%hi% would say "apples"
thanks in Advance
This can be done using a for loop:
for /f %%h in ("%hello%") do [command that uses %%h]
The behaviour of "for" in this circumstance is to split its input up into lines (there is only one, assuming there are no newline characters in your input variable), then split each line into tokens on spaces (you can change the delimiter using the "delim=[chars]" option) and pass the first token of each line to the specified command (you can use "tokens=n,n,..." to get at tokens other than the first on the line).
Note that AIUI you can only use a single letter variable name for the variable to receive the word, so you can't use %%hi as you requested.
(This is all untested, as I'm not at a machine running Windows at the moment, but ought to work if I'm reading the documentation correctly.)
set "hi="
for %%h in (%hello%) do if not defined hi set "hi=%%h"
echo %hi%
should work, as would
set "hi="
for %%h in (%hello%) do set "hi=%%h"&goto done
:done
echo %hi%
Note that the set "var=string" syntax ensures that trailing spaces on the line, as left by some editors, are not included in the value assigned.
You don't say clearly whether the value of hello is apples are awesomeor "apples are awesome" - the first is a string of three words with space-separators, the second a single string containing one "word" which contains spaces. I've assumed the former.