generate large array in dask - numpy

Question

I would like to calculate SVD from large matrix by Dask. However, I tried naively to create an empty 2D array and update in a loop, but Dask does not allow mutating the array.
So, I'm looking for a workaround. I tried saving large ( around 65,000 x 65,000, or even more) array into HDF5 via h5py, but updating the array in a loop is quite inefficient. Should I be using mmap, memory mapped numpy instead?
Below, I shared a sample code, without any dask implementation. Should I use dask.bag or dask.delayed for this operation?
The sample code is taking in long strings and in window size of 8, generates combinations of two-letter words. In actual data, the window size would be 20 and words will be 8-letter long. And, the input string can be 3 Gb long.
import itertools
import numpy as np
np.set_printoptions(threshold=np.Inf)
# generate all possible words of length 2 (AA, AC, AG, AT, CA, etc.)
# then get numerical index (AA -> 0, AC -> 1, etc.)
bases=['A','C','G','T']
all_two = [''.join(p) for p in itertools.product(bases, repeat=2)]
two_index = {x: y for (x,y) in zip(all_two, range(len(all_two)))}
# final array to fill, size is [ 16 possible words x 16 possible words ]
counts = np.zeros(shape=(16,16)) # in actual sample we expect 65000x65000 array
# sample sequences (these will be gigabytes long in actual sample)
seq1 = "AAAAACCATCGACTACGACTAC"
seq2 = "ACGATCACGACTACGACTAGATGCATCACGACTAAAAA"
# accumulate results
all_pairs=[]
def generate_pairs(sequence):
pairs=[]
for i in range(len(sequence)-8+1):
window=sequence[i:i+8]
words= [window[i:i+2] for i in range(0, len(window), 2)]
for pair in itertools.combinations(words,2):
pairs.append(pair)
return pairs
# use function for each sequence
all_pairs.extend(generate_pairs(seq1))
all_pairs.extend(generate_pairs(seq2))
# convert 1D array of pairs into 2D counts of pairs
# for each pair, lookup word index and increase corresponding cell
for j in all_pairs:
counts[ two_index[j[0]], two_index[j[1]] ] += 1
print(counts)
EDIT: I might have asked the question a little complicated, let me try to paraphrase it. I need to construct a single large 2D array of size ~65000x65000. The array needs to be filled with counting occurrences of (word1,word2) pairs. Since Dask does not allow item assignment/mutate for Dask array, I can not fill the array as pairs are processed. Is there a workaround to generate/fill a large 2D array with Dask?
Here's simpler code to test:
import itertools
import numpy as np
np.set_printoptions(threshold=np.Inf)
bases=['A','C','G','T']
all_two = [''.join(p) for p in itertools.product(bases, repeat=2)]
two_index = {x: y for (x,y) in zip(all_two, range(len(all_two)))}
seq = "AAAAACCATCGACTACGACTAC"
counts = np.zeros(shape=(16,16))
for i in range(len(seq)-8+1):
window=seq[i:i+8]
words= [window[i:i+2] for i in range(0, len(window), 2)]
for pair in itertools.combinations(words,2):
counts[two_index[pair[0]], two_index[pair[1]]] += 1 # problematic part!
print(counts)