awk '($1<1)|| ($1>22) {print $2}' $input > $output
If i put this line into Nextflow (written in groovy(Java)) pipeline script, it will show an error that mentions problem with variable notation (these: $1, $2). It works fine outside Nextflow. How else could i put in the variables here for it to work?
I tried
awk '(${1}<1)|| (${1}>22) {print ${2}}' $input > $output
Which outputs an empty file.
Desired output would be for it to just work in Nextflow.
If your process script section is enclosed in triple quotes, escape your literal $'s with a \ :
"""
awk '(\$1<1)|| (\$1>22) {print \$2}' $input > $output
"""
Wrapping with both your current methods cause nextflow to look for variables 1 and 2.
https://www.nextflow.io/docs/latest/script.html#string-interpolation
Related
I found some ways to pass external shell variables to an awk script, but I'm confused about ' and ".
First, I tried with a shell script:
$ v=123test
$ echo $v
123test
$ echo "$v"
123test
Then tried awk:
$ awk 'BEGIN{print "'$v'"}'
$ 123test
$ awk 'BEGIN{print '"$v"'}'
$ 123
Why is the difference?
Lastly I tried this:
$ awk 'BEGIN{print " '$v' "}'
$ 123test
$ awk 'BEGIN{print ' "$v" '}'
awk: cmd. line:1: BEGIN{print
awk: cmd. line:1: ^ unexpected newline or end of string
I'm confused about this.
#Getting shell variables into awk
may be done in several ways. Some are better than others. This should cover most of them. If you have a comment, please leave below. v1.5
Using -v (The best way, most portable)
Use the -v option: (P.S. use a space after -v or it will be less portable. E.g., awk -v var= not awk -vvar=)
variable="line one\nline two"
awk -v var="$variable" 'BEGIN {print var}'
line one
line two
This should be compatible with most awk, and the variable is available in the BEGIN block as well:
If you have multiple variables:
awk -v a="$var1" -v b="$var2" 'BEGIN {print a,b}'
Warning. As Ed Morton writes, escape sequences will be interpreted so \t becomes a real tab and not \t if that is what you search for. Can be solved by using ENVIRON[] or access it via ARGV[]
PS If you have vertical bar or other regexp meta characters as separator like |?( etc, they must be double escaped. Example 3 vertical bars ||| becomes -F'\\|\\|\\|'. You can also use -F"[|][|][|]".
Example on getting data from a program/function inn to awk (here date is used)
awk -v time="$(date +"%F %H:%M" -d '-1 minute')" 'BEGIN {print time}'
Example of testing the contents of a shell variable as a regexp:
awk -v var="$variable" '$0 ~ var{print "found it"}'
Variable after code block
Here we get the variable after the awk code. This will work fine as long as you do not need the variable in the BEGIN block:
variable="line one\nline two"
echo "input data" | awk '{print var}' var="${variable}"
or
awk '{print var}' var="${variable}" file
Adding multiple variables:
awk '{print a,b,$0}' a="$var1" b="$var2" file
In this way we can also set different Field Separator FS for each file.
awk 'some code' FS=',' file1.txt FS=';' file2.ext
Variable after the code block will not work for the BEGIN block:
echo "input data" | awk 'BEGIN {print var}' var="${variable}"
Here-string
Variable can also be added to awk using a here-string from shells that support them (including Bash):
awk '{print $0}' <<< "$variable"
test
This is the same as:
printf '%s' "$variable" | awk '{print $0}'
P.S. this treats the variable as a file input.
ENVIRON input
As TrueY writes, you can use the ENVIRON to print Environment Variables.
Setting a variable before running AWK, you can print it out like this:
X=MyVar
awk 'BEGIN{print ENVIRON["X"],ENVIRON["SHELL"]}'
MyVar /bin/bash
ARGV input
As Steven Penny writes, you can use ARGV to get the data into awk:
v="my data"
awk 'BEGIN {print ARGV[1]}' "$v"
my data
To get the data into the code itself, not just the BEGIN:
v="my data"
echo "test" | awk 'BEGIN{var=ARGV[1];ARGV[1]=""} {print var, $0}' "$v"
my data test
Variable within the code: USE WITH CAUTION
You can use a variable within the awk code, but it's messy and hard to read, and as Charles Duffy points out, this version may also be a victim of code injection. If someone adds bad stuff to the variable, it will be executed as part of the awk code.
This works by extracting the variable within the code, so it becomes a part of it.
If you want to make an awk that changes dynamically with use of variables, you can do it this way, but DO NOT use it for normal variables.
variable="line one\nline two"
awk 'BEGIN {print "'"$variable"'"}'
line one
line two
Here is an example of code injection:
variable='line one\nline two" ; for (i=1;i<=1000;++i) print i"'
awk 'BEGIN {print "'"$variable"'"}'
line one
line two
1
2
3
.
.
1000
You can add lots of commands to awk this way. Even make it crash with non valid commands.
One valid use of this approach, though, is when you want to pass a symbol to awk to be applied to some input, e.g. a simple calculator:
$ calc() { awk -v x="$1" -v z="$3" 'BEGIN{ print x '"$2"' z }'; }
$ calc 2.7 '+' 3.4
6.1
$ calc 2.7 '*' 3.4
9.18
There is no way to do that using an awk variable populated with the value of a shell variable, you NEED the shell variable to expand to become part of the text of the awk script before awk interprets it. (see comment below by Ed M.)
Extra info:
Use of double quote
It's always good to double quote variable "$variable"
If not, multiple lines will be added as a long single line.
Example:
var="Line one
This is line two"
echo $var
Line one This is line two
echo "$var"
Line one
This is line two
Other errors you can get without double quote:
variable="line one\nline two"
awk -v var=$variable 'BEGIN {print var}'
awk: cmd. line:1: one\nline
awk: cmd. line:1: ^ backslash not last character on line
awk: cmd. line:1: one\nline
awk: cmd. line:1: ^ syntax error
And with single quote, it does not expand the value of the variable:
awk -v var='$variable' 'BEGIN {print var}'
$variable
More info about AWK and variables
Read this faq.
It seems that the good-old ENVIRON awk built-in hash is not mentioned at all. An example of its usage:
$ X=Solaris awk 'BEGIN{print ENVIRON["X"], ENVIRON["TERM"]}'
Solaris rxvt
You could pass in the command-line option -v with a variable name (v) and a value (=) of the environment variable ("${v}"):
% awk -vv="${v}" 'BEGIN { print v }'
123test
Or to make it clearer (with far fewer vs):
% environment_variable=123test
% awk -vawk_variable="${environment_variable}" 'BEGIN { print awk_variable }'
123test
You can utilize ARGV:
v=123test
awk 'BEGIN {print ARGV[1]}' "$v"
Note that if you are going to continue into the body, you will need to adjust
ARGC:
awk 'BEGIN {ARGC--} {print ARGV[2], $0}' file "$v"
I just changed #Jotne's answer for "for loop".
for i in `seq 11 20`; do host myserver-$i | awk -v i="$i" '{print "myserver-"i" " $4}'; done
I had to insert date at the beginning of the lines of a log file and it's done like below:
DATE=$(date +"%Y-%m-%d")
awk '{ print "'"$DATE"'", $0; }' /path_to_log_file/log_file.log
It can be redirect to another file to save
Pro Tip
It could come handy to create a function that handles this so you dont have to type everything every time. Using the selected solution we get...
awk_switch_columns() {
cat < /dev/stdin | awk -v a="$1" -v b="$2" " { t = \$a; \$a = \$b; \$b = t; print; } "
}
And use it as...
echo 'a b c d' | awk_switch_columns 2 4
Output:
a d c b
I have fasta file that contains two gene sequences and what I want to do is remove the fasta header (line starting with ">"), concatenate the rest of the lines and output that sequence
Here is my fasta sequence (genome.fa):
>Potrs164783
AGGAAGTGTGAGATTGAAAAAACATTACTATTGAGGAATTTTTGACCAGATCAGAATTGAACCAACATGATGAAGGGGAT
TGTTTGCCATCAGAATATGGCATGAAATTTCTCCCCTAGATCGGTTCAAGCTCCTGTAGGTTTGGAGTCCTTAGTGAGAA
CTTTCTTAAGAGAATCTAATCTGGTCTGTTCCTCGTCATAAGTTAAAGAAAAACTTGAAACAAATAACAAGCATGCATAA
>Potrs164784
TTACCCTCTACCAGCACCAATGCCTATGATCTTACAAAAATCCTTAATAAAAAGAAATCCAAAACCATTGTTACCATTCC
GGAATTACATTCTGAGATAAAAACCCTCAAATCTGAATTACAATCCCTTAAACAAGCCCAACAAAAAGACTCTGCCATAC
Desired output
AGGAAGTGTGAGATTGAAAAAACATTACTATTGAGGAATTTTTGACCAGATCAGAATTGAACCAACATGATGAAGGGGAT
TGTTTGCCATCAGAATATGGCATGAAATTTCTCCCCTAGATCGGTTCAAGCTCCTGTAGGTTTGGAGTCCTTAGTGAGAA
CTTTCTTAAGAGAATCTAATCTGGTCTGTTCCTCGTCATAAGTTAAAGAAAAACTTGAAACAAATAACAAGCATGCATAA
TTACCCTCTACCAGCACCAATGCCTATGATCTTACAAAAATCCTTAATAAAAAGAAATCCAAAACCATTGTTACCATTCC
GGAATTACATTCTGAGATAAAAACCCTCAAATCTGAATTACAATCCCTTAAACAAGCCCAACAAAAAGACTCTGCCATAC
I am using awk to do this but I am getting this error
awk 'BEGIN{filename="file1"}{if($1 ~ />/){filename=$1; sub(/>/,"",filename); print filename;} print $0 >filename.fa;}' ../genome.fa
awk: syntax error at source line 1
context is
BEGIN{filename="file1"}{if($1 ~ />/){filename=$1; sub(/>/,"",filename); print filename;} print $0 >>> >filename. <<< fa;}
awk: illegal statement at source line 1
I am basically a python person and I was given this script by someone. What am I doing wrong here?
I realized that i was not clear and so i am pasting the whole code that i got from someone. The input file and desired output remains the same
mkdir split_genome;
cd split_genome;
awk 'BEGIN{filename="file1"}{if($1 ~ />/){filename=$1; sub(/>/,"",filename); print filename;} print $0 >filename.fa;}' ../genome.fa;
ls -1 `pwd`/* > ../scaffold_list.txt;
cd ..;
If all you want to do is produce the desired output shown in your question, other solutions will work.
However, the script you have is trying to print each sequence to a file that is named using its header, and the extension .fa.
The syntax error you're getting is because filename.fa is neither a variable or a fixed string. While no Awk will allow you to print to filename.fa because it is neither in quotes or a variable (varaible names can't have a . in them), BSD Awk does not allow manipulating strings when they currently act as a file name where GNU Awk does.
So the solution:
print $0 > filename".fa"
would produce the same error in BSD Awk, but would work in GNU Awk.
To fix this, you can append the extension ".fa" to filename at assignment.
This will do the job:
$ awk '{if($0 ~ /^>/) filename=substr($0, 2)".fa"; else print $0 > filename}' file
$ cat Potrs164783.fa
AGGAAGTGTGAGATTGAAAAAACATTACTATTGAGGAATTTTTGACCAGATCAGAATTGAACCAACATGATGAAGGGGAT
TGTTTGCCATCAGAATATGGCATGAAATTTCTCCCCTAGATCGGTTCAAGCTCCTGTAGGTTTGGAGTCCTTAGTGAGAA
CTTTCTTAAGAGAATCTAATCTGGTCTGTTCCTCGTCATAAGTTAAAGAAAAACTTGAAACAAATAACAAGCATGCATAA
$ cat Potrs164784.fa
TTACCCTCTACCAGCACCAATGCCTATGATCTTACAAAAATCCTTAATAAAAAGAAATCCAAAACCATTGTTACCATTCC
GGAATTACATTCTGAGATAAAAACCCTCAAATCTGAATTACAATCCCTTAAACAAGCCCAACAAAAAGACTCTGCCATAC
You'll notice I left out the BEGIN{filename="file1"} declaration statement as it is unnecessary. Also, I replaced the need for sub(...) by using the string function substr as it is more clear and requires fewer actions.
The awk code that you show attempts to do something different than produce the output that you want. Fortunately, there are much simpler ways to obtain your desired output. For example:
$ grep -v '>' ../genome.fa
AGGAAGTGTGAGATTGAAAAAACATTACTATTGAGGAATTTTTGACCAGATCAGAATTGAACCAACATGATGAAGGGGAT
TGTTTGCCATCAGAATATGGCATGAAATTTCTCCCCTAGATCGGTTCAAGCTCCTGTAGGTTTGGAGTCCTTAGTGAGAA
CTTTCTTAAGAGAATCTAATCTGGTCTGTTCCTCGTCATAAGTTAAAGAAAAACTTGAAACAAATAACAAGCATGCATAA
TTACCCTCTACCAGCACCAATGCCTATGATCTTACAAAAATCCTTAATAAAAAGAAATCCAAAACCATTGTTACCATTCC
GGAATTACATTCTGAGATAAAAACCCTCAAATCTGAATTACAATCCCTTAAACAAGCCCAACAAAAAGACTCTGCCATAC
Alternatively, if you had intended to have all non-header lines concatenated into one line:
$ sed -n '/^>/!H; $!d; x; s/\n//gp' ../genome.fa
AGGAAGTGTGAGATTGAAAAAACATTACTATTGAGGAATTTTTGACCAGATCAGAATTGAACCAACATGATGAAGGGGATTGTTTGCCATCAGAATATGGCATGAAATTTCTCCCCTAGATCGGTTCAAGCTCCTGTAGGTTTGGAGTCCTTAGTGAGAACTTTCTTAAGAGAATCTAATCTGGTCTGTTCCTCGTCATAAGTTAAAGAAAAACTTGAAACAAATAACAAGCATGCATAATTACCCTCTACCAGCACCAATGCCTATGATCTTACAAAAATCCTTAATAAAAAGAAATCCAAAACCATTGTTACCATTCCGGAATTACATTCTGAGATAAAAACCCTCAAATCTGAATTACAATCCCTTAAACAAGCCCAACAAAAAGACTCTGCCATAC
Try this to print lines not started by > and in one line:
awk '!/^>/{printf $0}' genome.fa > filename.fa
With carriage return:
awk '!/^>/' genome.fa > filename.fa
To create single files named by the headers:
awk 'split($0,a,"^>")>1{file=a[2];next}{print >file}' genome.fa
The following script
#! /bin/bash
B=5
#FILE INPUT
cat <<EOF > awk.in
BEGIN{b=$B;printf("B is %s\n", b)}
EOF
awk -f awk.in sometextfile.txt
#COMMANDLINE INPUT
awk 'BEGIN{b=$B;printf("B is %s\n", b)}' sometextfile.txt
produces the output
B is 5
B is
The commands I am issuing to awk are exactly the same, so why is the variable B interpreted correctly in the first case but not in the latter?
Thanks!
In the line
awk 'BEGIN{b=$B;printf("B is %s\n", b)}' sometextfile.txt
The string literal 'BEGIN{b=$B;printf("B is %s\n", b)}' is singly-quoted, therefore $B is not expanded and treated as awk code. In awk code, B is uninitialized, so $B becomes $0, which is in the BEGIN block empty.
In contrast, shell variables in here documents (as in your first example) are expanded, so awk.in ends up containing the value that $B had in the shell script. This, by the way, would have made writing awk code very painful as soon as you'd tried to use a field variable (named $1, $2, and so forth) or the full line (named $0) because you'd have to manually resolve the ambiguity between the awk fields and shell variables of the same name.
Use
awk -v b="$B" 'BEGIN{ printf("B is %s\n", b) }' sometextfile.txt
to make a shell variable known to awk code. Do not try to substitute it directly into awk code; it isn't necessary, you will hate writing awk code that way, and it leads to code injection problems, especially when B comes from an untrusted source.
For my case, if a certain pattern is found as the second field of one line in a file, then I need print the first two fields. And it should be able to handle case with special symbol like backslash.
My solution is first using sed to replace \ with \\, then pass the new variable to awk, then awk will parse \\ as \ then match the field 2.
escaped_str=$( echo "$pattern" | sed 's/\\/\\\\/g')
input | awk -v awk_escaped_str="$escaped_str" '$2==awk_escaped_str { $0=$1 " " $2 " "}; { print } '
While this seems too complicated, and cannot handle various case.
Is there a better way which is more simpler and could cover all other special symbol?
The way to pass a shell variable to awk without backslashes being interpreted is to pass it in the arg list instead of populating an awk variable outside of the script:
$ shellvar='a\tb'
$ awk -v awkvar="$shellvar" 'BEGIN{ printf "<%s>\n",awkvar }'
<a b>
$ awk 'BEGIN{ awkvar=ARGV[1]; ARGV[1]=""; printf "<%s>\n",awkvar }' "$shellvar"
<a\tb>
and then you can search a file for it as a string using index() or ==:
$ cat file
a b
a\tb
$ awk 'BEGIN{ awkvar=ARGV[1]; ARGV[1]="" } index($0,awkvar)' "$shellvar" file
a\tb
$ awk 'BEGIN{ awkvar=ARGV[1]; ARGV[1]="" } $0 == awkvar' "$shellvar" file
a\tb
You need to set ARGV[1]="" after populating the awk variable to avoid the shell variable value also being treated as a file name. Unlike any other way of passing in a variable, ALL characters used in a variable this way are treated literally with no "special" meaning.
There are three variations you can try without needing to escape your pattern:
This one tests literal strings. No regex instance is interpreted:
$2 == expr
This one tests if a literal string is a subset:
index($2, expr)
This one tests regex pattern:
$2 ~ pattern
I am using the below code to change an existing awk script so that I can add more and more cases with a simple command.
echo `awk '{if(/#append1/){print "pref'"$1"'=0\n" $0 "\n"} else{print $0 "\n"}}' tf.a
note that the first print is "pref'"$1"'=0\n" so it is referring to the variable $1 in its environment, not in awk itself.
The command ./tfb.a "c" should change the code from:
BEGIN{
#append1
}
...
to:
BEGIN{
prefc=0
#append1
}
...
However, it gives me everything on one line.
Does anyone know why this is?
If you take awk right out of the equation you can see what's going on:
# Use a small test file instead of an awk script
$ cat xxx
hello
there
$ echo `cat xxx`
hello there
$ echo "`cat xxx`"
hello
there
$ echo "$(cat xxx)"
hello
there
$
The backtick operator expands the output into shell "words" too soon. You could play around with the $IFS variable in the shell (yikes), or you could just use double-quotes.
If you're running a modern sh (e.g. ksh or bash, not the "classic" Bourne sh), you may also want to use the $() syntax (it's easier to find the matching start/end delimiter).
do it like this. pass the variable from shell to awk properly using -v
#!/bin/bash
toinsert="$1"
awk -v toinsert=$toinsert '
/#append1/{
$0="pref"toinsert"=0\n"$0
}
{print}
' file > temp
mv temp file
output
$ cat file
BEGIN{
#append1
}
$ ./shell.sh c
BEGIN{
prefc=0
#append1
}