I searched a lot but could not find a solution to my issue. I have a file that looks like:
>HEADER1
AACTGGTTACGTGGTTCTCT
>HEADER2
GGTTTCTC
>HEADER3
CCAGGTTTCGAGGGGTTACGGGGTA
I want to remove GGTT pattern and everything before it. So basically there are several of these patterns in some of the lines so I want to remove all of them including everything before the pattern or among them.
The desired output should look like:
>HEADER1
CTCT
>HEADER2
TCTC
>HEADER3
ACGGGGTA
I tried suggested ways but could not be able to adjust it to my data.
Thank you in Advance for your help.
If it's not possible for your headers to include GGTT, I suppose the easiest would be:
$ sed 's/.*GGTT//' file
>HEADER1
CTCT
>HEADE2
TCTC
>HEADER3
ACGGGGTA
If your headers might contain GGTT, then awk probably be better:
$ awk '!/^>/ {sub(/.*GGTT/, "")}1' file
>HEADER1
CTCT
>HEADE2
TCTC
>HEADER3
ACGGGGTA
In both cases, the .*GGTT is "greedy", so it doesn't matter if there are multiple instances of GGTT, it will always match up to and remove everything through the last occurrence.
In the awk version, the pattern !/^>/ makes sure that subsitution is only done on lines that do not start with >.
Note that in general, sequences in fasta format as shown in the question may span multiple lines (= they are often wrapped to 80 or 100 nucleotides per line). This answer handles such cases correctly as well, unlike some other answers in this thread.
Use these two Perl one-liners connected by a pipe. The first one-liner does all of the common reformatting of the fasta sequences that is necessary in this and similar cases. It removes newlines and whitespace in the sequence (which also unwraps the sequence), but does not change the sequence header lines. It also properly handles leading and trailing whitespace/newlines in the file. The second one-liner actually removes everything up to and including the last GGTT in the sequence, in a case-insensitive manner.
Note: If GGTT is at the end of the sequence, the output will be a header plus an empty sequence. See seq4 in the example below. This may cause issues with some bioinformatics tools used downstream.
# Create the input for testing:
cat > in.fa <<EOF
>seq1 with blanks
ACGT GGTT ACGT
>seq2 with newlines
ACGT
GGTT
ACGT
>seq3 without blanks or newlines
ACGTGGTTACGT
>seq4 everything should be deleted, with empty sequence in the output
ACGTGGTTACGTGGTT
>seq5 lowercase
acgtggttacgt
EOF
# Reformat to single-line fasta, then delete subsequences:
perl -ne 'chomp; if ( /^>/ ) { print "\n" if $n; print "$_\n"; $n++; } else { s/\s+//g; print; } END { print "\n"; }' in.fa | \
perl -pe 'next if /^>/; s/.*GGTT//i;' > out.fa
Output in file out.fa:
>seq1 with blanks
ACGT
>seq2 with newlines
ACGT
>seq3 without blanks or newlines
ACGT
>seq4 everything should be deleted, with empty sequence in the output
>seq5 lowercase
acgt
The Perl one-linera use these command line flags:
-e : Tells Perl to look for code in-line, instead of in a file.
-n : Loop over the input one line at a time, assigning it to $_ by default.
-p : Loop over the input one line at a time, assigning it to $_ by default. Add print $_ after each loop iteration.
chomp : Remove the input line separator (\n on *NIX).
if ( /^>/ ) : Test if the current line is a sequence header line.
$n : This variable is undefined (false) at the beginning, and true after seeing the first sequence header, in which case we print an extra newline. This newline goes at the end of each sequence, starting from the first sequence.
END { print "\n"; } : Print the final newline after the last sequence.
s/\s+//g; print; : If the current line is sequence (not header), remove all the whitespace and print without the terminal newline.
next if /^>/; : Skip the header lines.
s/.*GGTT//i; : Replace everything (.*) up to and including the the last GGTT with nothing (= delete it). The /i modifier means case-insensitive match.
SEE ALSO:
perldoc perlrun: how to execute the Perl interpreter: command line switches
perldoc perlre: Perl regular expressions (regexes)
perldoc perlre: Perl regular expressions (regexes): Quantifiers; Character Classes and other Special Escapes; Assertions; Capture groups
Remove line breaks in a FASTA file
In the following file I want to replace all the ; by , with the exception that, when there is a string (delimited with two "), it should not replace the ; inside it.
Example:
Input
A;B;C;D
5cc0714b9b69581f14f6427f;5cc0714b9b69581f14f6428e;1;"5cc0714b9b69581f14f6427f;16a4fba8d13";xpto;
5cc0723b9b69581f14f64285;5cc0723b9b69581f14f64294;2;"5cc0723b9b69581f14f64285;16a4fbe3855";xpto;
5cc072579b69581f14f6428a;5cc072579b69581f14f64299;3;"5cc072579b69581f14f6428a;16a4fbea632";xpto;
output
A,B,C,D
5cc0714b9b69581f14f6427f,5cc0714b9b69581f14f6428e,1,"5cc0714b9b69581f14f6427f;16a4fba8d13",xpto,
5cc0723b9b69581f14f64285,5cc0723b9b69581f14f64294,2,"5cc0723b9b69581f14f64285;16a4fbe3855",xpto,
5cc072579b69581f14f6428a,5cc072579b69581f14f64299,3,"5cc072579b69581f14f6428a;16a4fbea632",xpto,
For sed I have: sed 's/;/,/g' input.txt > output.txt but this would replace everything.
The regex for the " delimited string: \".*;.*\" .
(A regex for hexadecimal would be better -- something like: [0-9a-fA-F]+)
My problem is combining it all to make a grep -o / sed that replaces everything except for that pattern.
The file size is in the order of two digit Gb (max 99Gb), so performance is important. Relevant.
Any ideas are appreciated.
sed is for doing simple s/old/new on individual strings. grep is for doing g/re/p. You're not trying to do either of those tasks so you shouldn't be considering either of those tools. That leaves the other standard UNIX tool for manipulating text - awk.
You have a ;-separated CSV that you want to make ,-separated. That's simply:
$ awk -v FPAT='[^;]*|"[^"]+"' -v OFS=',' '{$1=$1}1' file
A,B,C,D
5cc0714b9b69581f14f6427f,5cc0714b9b69581f14f6428e,1,"5cc0714b9b69581f14f6427f;16a4fba8d13",xpto,
5cc0723b9b69581f14f64285,5cc0723b9b69581f14f64294,2,"5cc0723b9b69581f14f64285;16a4fbe3855",xpto,
5cc072579b69581f14f6428a,5cc072579b69581f14f64299,3,"5cc072579b69581f14f6428a;16a4fbea632",xpto,
The above uses GNU awk for FPAT. See What's the most robust way to efficiently parse CSV using awk? for more details on parsing CSVs with awk.
If I get correctly your requirements, one option would be to make a three pass thing.
From your comment about hex, I'll consider nothing like # will come in the input so you can do (using GNU sed) :
sed -E 's/("[^"]+);([^"]+")/\1#\2/g' original > transformed
sed -i 's/;/,/g' transformed
sed -i 's/#/;/g' transformed
The idea being to replace the ; when within quotes by something else and write it to a new file, then replace all ; by , and then set back the ; in place within the same file (-i flag of sed).
The three pass can be combined in a single command with
sed -E 's/("[^"]+);([^"]+")/\1#\2/g;s/;/,/g;s/#/;/g' original > transformed
That said, there's probably a bunch of csv parser witch already handle quoted fields that you can probably use in the final use case as I bet this is just an intermediary step for something else later in the chain.
From Ed Morton's comment: if you do it in one pass, you can use \n as replacement separator as there can't be a newline in the text considered line by line.
This might work for you (GNU sed):
sed -E ':a;s/^([^"]*("[^"]*"[^"]*)*"[^";]*);/\1\n/;ta;y/;/,/;y/\n/;/' file
Replace ;'s inside double quotes with newlines, transpose ;'s to ,'s and then transpose newlines to ;'s.
Lets say my data looks like this
iqwertyuiop
and I want to replace all the letters i after column 3 with a Z.. so my output would look like this
iqwertyuZop
How can I do this with sed or awk?
It's not clear what you mean by "column" but maybe this is what you want using GNU awk for gensub():
$ echo iqwertyuiop | awk '{print substr($0,1,3) gensub(/i/,"Z","g",substr($0,4))}'
iqwertyuZop
Perl is handy for this: you can assign to a substring
$ echo "iiiiii" | perl -pe 'substr($_,3) =~ s/i/Z/g'
iiiZZZ
This would totally be ideal for the tr command, if only you didn't have the requirement that the first 3 characters remain untouched.
However, if you are okay using some bash tricks plus cut and paste, you can split the file into two parts and paste them back together afterwords:
paste -d'\0' <(cut -c-3 foo) <(cut -c4- foo | tr i Z)
The above uses paste to rejoin together the two parts of the file that get split with cut. The second section is piped through tr to translate i's to Z's.
(1) Here's a short-and-simple way to accomplish the task using GNU sed:
sed -r -e ':a;s/^(...)([^i]*)i/\1\2Z/g;ta'
This entails looping (t), and so would not be as efficient as non-looping approaches. The above can also be written using escaped parentheses instead of unescaped characters, and so there is no real need for the -r option. Other implementations of sed should (in principle) be up to the task as well, but your MMV.
(2) It's easy enough to use "old awk" as well:
awk '{s=substr($0,4);gsub(/i/,"Z",s); print substr($0,1,3) s}'
The most intuitive way would be to use awk:
awk 'BEGIN{FS="";OFS=FS}{for(i=4;i<=NF;i++){if($i=="i"){$i="Z"}}}1' file
FS="" splits the input string by characters into fields. We iterate trough character/field 4 to end and replace i by Z.
The final 1 evaluates to true and make awk print the modified input line.
With sed it looks not very intutive but still it is possible:
sed -r '
h # Backup the current line in hold buffer
s/.{3}// # Remove the first three characters
s/i/Z/g # Replace all i by Z
G # Append the contents of the hold buffer to the pattern buffer (this adds a newline between them)
s/(.*)\n(.{3}).*/\2\1/ # Remove that newline ^^^ and assemble the result
' file
I have a case where I want to use input from a file as the format for printf() in awk. My formatting works when I set it in a string within the code, but it doesn't work when I load it from input.
Here's a tiny example of the problem:
$ # putting the format in a variable works just fine:
$ echo "" | awk -vs="hello:\t%s\n\tfoo" '{printf(s "bar\n", "world");}'
hello: world
foobar
$ # But getting the format from an input file does not.
$ echo "hello:\t%s\n\tfoo" | awk '{s=$0; printf(s "bar\n", "world");}'
hello:\tworld\n\tfoobar
$
So ... format substitutions work ("%s"), but not special characters like tab and newline. Any idea why this is happening? And is there a way to "do something" to input data to make it usable as a format string?
UPDATE #1:
As a further example, consider the following using bash heretext:
[me#here ~]$ awk -vs="hello: %s\nworld: %s\n" '{printf(s, "foo", "bar");}' <<<""
hello: foo
world: bar
[me#here ~]$ awk '{s=$0; printf(s, "foo", "bar");}' <<<"hello: %s\nworld: %s\n"
hello: foo\nworld: bar\n[me#here ~]$
As far as I can see, the same thing happens with multiple different awk interpreters, and I haven't been able to locate any documentation that explains why.
UPDATE #2:
The code I'm trying to replace currently looks something like this, with nested loops in shell. At present, awk is only being used for its printf, and could be replaced with a shell-based printf:
#!/bin/sh
while read -r fmtid fmt; do
while read cid name addy; do
awk -vfmt="$fmt" -vcid="$cid" -vname="$name" -vaddy="$addy" \
'BEGIN{printf(fmt,cid,name,addy)}' > /path/$fmtid/$cid
done < /path/to/sampledata
done < /path/to/fmtstrings
Example input would be:
## fmtstrings:
1 ID:%04d Name:%s\nAddress: %s\n\n
2 CustomerID:\t%-4d\t\tName: %s\n\t\t\t\tAddress: %s\n
3 Customer: %d / %s (%s)\n
## sampledata:
5 Companyname 123 Somewhere Street
12 Othercompany 234 Elsewhere
My hope was that I'd be able to construct something like this to do the entire thing with a single call to awk, instead of having nested loops in shell:
awk '
NR==FNR { fmts[$1]=$2; next; }
{
for(fmtid in fmts) {
outputfile=sprintf("/path/%d/%d", fmtid, custid);
printf(fmts[fmtid], $1, $2) > outputfile;
}
}
' /path/to/fmtstrings /path/to/sampledata
Obviously, this doesn't work, both because of the actual topic of this question and because I haven't yet figured out how to elegantly make awk join $2..$n into a single variable. (But that's the topic of a possible future question.)
FWIW, I'm using FreeBSD 9.2 with its built in, but I'm open to using gawk if a solution can be found with that.
Why so lengthy and complicated an example? This demonstrates the problem:
$ echo "" | awk '{s="a\t%s"; printf s"\n","b"}'
a b
$ echo "a\t%s" | awk '{s=$0; printf s"\n","b"}'
a\tb
In the first case, the string "a\t%s" is a string literal and so is interpreted twice - once when the script is read by awk and then again when it is executed, so the \t is expanded on the first pass and then at execution awk has a literal tab char in the formatting string.
In the second case awk still has the characters backslash and t in the formatting string - hence the different behavior.
You need something to interpret those escaped chars and one way to do that is to call the shell's printf and read the results (corrected per #EtanReiser's excellent observation that I was using double quotes where I should have had single quotes, implemented here by \047, to avoid shell expansion):
$ echo 'a\t%s' | awk '{"printf \047" $0 "\047 " "b" | getline s; print s}'
a b
If you don't need the result in a variable, you can just call system().
If you just wanted the escape chars expanded so you don't need to provide the %s args in the shell printf call, you'd just need to escape all the %s (watching out for already-escaped %s).
You could call awk instead of the shell printf if you prefer.
Note that this approach, while clumsy, is much safer than calling an eval which might just execute an input line like rm -rf /*.*!
With help from Arnold Robbins (the creator of gawk), and Manuel Collado (another noted awk expert), here is a script which will expand single-character escape sequences:
$ cat tst2.awk
function expandEscapes(old, segs, segNr, escs, idx, new) {
split(old,segs,/\\./,escs)
for (segNr=1; segNr in segs; segNr++) {
if ( idx = index( "abfnrtv", substr(escs[segNr],2,1) ) )
escs[segNr] = substr("\a\b\f\n\r\t\v", idx, 1)
new = new segs[segNr] escs[segNr]
}
return new
}
{
s = expandEscapes($0)
printf s, "foo", "bar"
}
.
$ awk -f tst2.awk <<<"hello: %s\nworld: %s\n"
hello: foo
world: bar
Alternatively, this shoudl be functionally equivalent but not gawk-specific:
function expandEscapes(tail, head, esc, idx) {
head = ""
while ( match(tail, /\\./) ) {
esc = substr( tail, RSTART + 1, 1 )
head = head substr( tail, 1, RSTART-1 )
tail = substr( tail, RSTART + 2 )
idx = index( "abfnrtv", esc )
if ( idx )
esc = substr( "\a\b\f\n\r\t\v", idx, 1 )
head = head esc
}
return (head tail)
}
If you care to, you can expand the concept to octal and hex escape sequences by changing the split() RE to
/\\(x[0-9a-fA-F]*|[0-7]{1,3}|.)/
and for a hex value after the \\:
c = sprintf("%c", strtonum("0x" rest_of_str))
and for an octal value:
c = sprintf("%c", strtonum("0" rest_of_str))
Since the question explicitly asks for an awk solution, here's one which works on all the awks I know of. It's a proof-of-concept; error handling is abysmal. I've tried to indicate places where that could be improved.
The key, as has been noted by various commentators, is that awk's printf -- like the C standard function it is based on -- does not interpret backslash-escapes in the format string. However, awk does interpret them in command-line assignment arguments.
awk 'BEGIN {if(ARGC!=3)exit(1);
fn=ARGV[2];ARGC=2}
NR==FNR{ARGV[ARGC++]="fmt="substr($0,length($1)+2);
ARGV[ARGC++]="fmtid="$1;
ARGV[ARGC++]=fn;
next}
{match($0,/^ *[^ ]+[ ]+[^ ]+[ ]+/);
printf fmt,$1,$2,substr($0,RLENGTH+1) > ("data/"fmtid"/"$1)
}' fmtfile sampledata
(
What's going on here is that the 'FNR==NR' clause (which executes only on the first file) adds the values (fmtid, fmt) from each line of the first file as command-line assignments, and then inserts the data file name as a command-line argument. In awk, assignments as command line arguments are simply executed as though they were assignments from a string constant with implicit quotes, including backslash-escape processing (except that if the last character in the argument is a backslash, it doesn't escape the implicit closing double-quote). This behaviour is mandated by Posix, as is the order in which arguments are processed which makes it possible to add arguments as you go.
As written, the script must be provided with exactly two arguments: the formats and the data (in that order). There is some room for improvement, obviously.
The snippet also shows two ways of concatenating trailing fields.
In the format file, I assume that the lines are well behaved (no leading spaces; exactly one space after the format id). With those constraints, substr($0, length($1)+2) is precisely the part of the line after the first field and a single space.
Processing the datafile, it may be necessary to do this with fewer constraints. First, the builtin match function is called with the regular expression /^ *[^ ]+[ ]+[^ ]+[ ]+/ which matches leading spaces (if any) and two space-separated fields, along with the following spaces. (It would be better to allow tabs, as well.) Once the regex matches (and matching shouldn't be assumed, so there's another thing to fix), the variables RSTART and RLENGTH are set, so substr($0, RLENGTH+1) picks up everything starting with the third field. (Again, this is all Posix-standard behaviour.)
Honestly, I'd use the shell printf for this problem, and I don't understand why you feel that solution is somehow sub-optimal. The shell printf interprets backslash escapes in formats, and the shell read -r will do the line splitting the way you want. So there's no reason for awk at all, as far as I can see.
Ed Morton shows the problem clearly (edit: and it's now complete, so just go accept it): awk's string literal processing handled the escapes, and file I/O code isn't a lexical analyzer.
It's an easy fix: decide what escapes you want to support, and support them. Here's a one-liner form if you're doing special-purpose work that doesn't need to handle escaped backslashes
awk '{ gsub(/\\n/,"\n"); gsub(/\\t/,"\t"); printf($0 "bar\n", "world"); }' <<\EOD
hello:\t%s\n\tfoo
EOD
but for doit-and-forgetit peace of mind just use the full form in the linked answer.
#Ed Morton's answer explains the problem well.
A simple workaround is to:
pass the format-string file contents via an awk variable, using command substitution,
assuming that file is not too large to be read into memory in full.
Using GNU awk or mawk:
awk -v formats="$(tr '\n' '\3' <fmtStrings)" '
# Initialize: Split the formats into array elements.
BEGIN {n=split(formats, aFormats, "\3")}
# For each data line, loop over all formats and print.
{ for(i=1;i<n;++i) {printf aFormats[i] "\n", $1, $2, $3} }
' sampleData
Note:
The advantage of this solution is that it works generically - you don't need to anticipate specific escape sequences and handle them specially.
On FreeBSD awk, this almost works, but - sadly - split() still splits by newlines, despite being given an explicit separator - this smells like a bug. Observed on versions 20070501 (OS X 10.9.4) and 20121220 (FreeBSD 10.0).
The above solves the core problem (for brevity, it omits stripping the ID from the front of the format strings and omits the output-file creation logic).
Explanation:
tr '\n' '\3' <fmtStrings replaces actual newlines in the format-strings file with \3 (0x3) characters, so as to be able to later distinguish them from the \n escape sequences embedded in the lines, which awk turns into actual newlines when assigning to variable formats (as desired).
\3 (0x3) - the ASCII end-of-text char. - was arbitrarily chosen as an auxiliary separator that is assumed not to be present in the input file.
Note that using \0 (NUL) is NOT an option, because awk interprets that as an empty string, causing split() to split the string into individual characters.
Inside the BEGIN block of the awk script, split(formats, aFormats, "\3") then splits the combined format strings back into individual format strings.
I had to create another answer to start clean, I believe I've come to a good solution, again with perl:
echo '%10s\t:\t%10s\r\n' | perl -lne 's/((?:\\[a-zA-Z\\])+)/qq[qq[$1]]/eeg; printf "$_","hi","hello"'
hi : hello
That bad boy s/((?:\\[a-zA-Z\\])+)/qq[qq[$1]]/eeg will translate any meta character I can think of, let us take a look with cat -A :
echo '%10s\t:\t%10s\r\n' | perl -lne 's/((?:\\[a-zA-Z\\])+)/qq[qq[$1]]/eeg; printf "$_","hi","hello"' | cat -A
hi^I:^I hello^M$
PS. I didn't create that regex, I googled unquote meta and found here
What you are trying to do is called templating. I would suggest that shell tools are not the best tools for this job. A safe way to go would be to use a templating library such as Template Toolkit for Perl, or Jinja2 for Python.
The problem lies in the non-interpretation of the special characters \t and \n by echo: it makes sure that they are understood as as-is strings, and not as tabulations and newlines. This behavior can be controlled by the -e flag you give to echo, without changing your awk script at all:
echo -e "hello:\t%s\n\tfoo" | awk '{s=$0; printf(s "bar\n", "world");}'
tada!! :)
EDIT:
Ok, so after the point rightfully raised by Chrono, we can devise this other answer corresponding to the original request to have the pattern read from a file:
echo "hello:\t%s\n\tfoo" > myfile
awk 'BEGIN {s="'$(cat myfile)'" ; printf(s "bar\n", "world")}'
Of course in the above we have to be careful with the quoting, as the $(cat myfile) is not seen by awk but interpreted by the shell.
This looks extremely ugly, but it works for this particular problem:
s=$0;
gsub(/'/, "'\\''", s);
gsub(/\\n/, "\\\\\\\\n", s);
"printf '%b' '" s "'" | getline s;
gsub(/\\\\n/, "\n", s);
gsub(/\\n/, "\n", s);
printf(s " bar\n", "world");
Replace all single quotes with shell-escaped single quotes ('\'').
Replace all escaped newline sequences that appear normally as \n with the sequence that appears as \\\\n. It would suffice to use \\\\n as the actual replacement string (meaning \\n would print if you printed it), but the version of gawk I have messes things up in POSIX mode.
Invoke the shell to execute printf '%b' 'escape'\''d format' and use awk's getline statement to retrieve the line.
Unescape \\n to yield a newline. This step wouldn't be necessary if gawk in POSIX mode played nicely.
Unescape \n to yield a newline.
Otherwise you're left to call the gsub function for each possible escape sequence, which is terrible for \001, \002, etc.
Graham,
Ed Morton's solution is the best (and perhaps only) one available.
I'm including this answer for a better explanation of WHY you're seeing what you're seeing.
A string is a string. The confusing part here is WHERE awk does the translation of \t to a tab, \n to a newline, etc. It appears NOT to be the case that the backslash and t get translated when used in a printf format. Instead, the translation happens at assignment, so that awk stores the tab as part of the format rather than translating when it runs the printf.
And this is why Ed's function works. When read from stdin or a file, no assignment is performed that will implement the translation of special characters. Once you run the command s="a\tb"; in awk, you have a three character string containing no backslash or t.
Evidence:
$ echo "a\tb\n" | awk '{ s=$0; for (i=1;i<=length(s);i++) {printf("%d\t%c\n",i,substr(s,i,1));} }'
1 a
2 \
3 t
4 b
5 \
6 n
vs
$ awk 'BEGIN{s="a\tb\n"; for (i=1;i<=length(s);i++) {printf("%d\t%c\n",i,substr(s,i,1));} }'
1 a
2
3 b
4
And there you go.
As I say, Ed's answer provides an excellent function for what you need. But if you can predict what your input will look like, you can probably get away with a simpler solution. Knowing how this stuff gets parsed, if you have a limited set of characters you need to translate, you may be able to survive with something simple like:
s=$0;
gsub(/\\t/,"\t",s);
gsub(/\\n/,"\n",s);
That's a cool question, I don't know the answer in awk, but in perl you can use eval :
echo '%10s\t:\t%-10s\n' | perl -ne ' chomp; eval "printf (\"$_\", \"hi\", \"hello\")"'
hi : hello
PS. Be aware of code injection danger when you use eval in any language, no just eval any system call can't be done blindly.
Example in Awk:
echo '$(whoami)' | awk '{"printf \"" $0 "\" " "b" | getline s; print s}'
tiago
What if the input was $(rm -rf /)? You can guess what would happen :)
ikegami adds:
Why would even think of using eval to convert \n to newlines and \t to tabs?
echo '%10s\t:\t%-10s\n' | perl -e'
my %repl = (
n => "\n",
t => "\t",
);
while (<>) {
chomp;
s{\\(?:(\w)|(\W))}{
if (defined($2)) {
$2
}
elsif (exists($repl{$1})) {
$repl{$1}
}
else {
warn("Unrecognized escape \\$1.\n");
$1
}
}eg;
printf($_, "hi", "hello");
}
'
Short version:
echo '%10s\t:\t%-10s\n' | perl -nle'
s/\\(?:(n)|(t)|(.))/$1?"\n":$2?"\t":$3/seg;
printf($_, "hi", "hello");
'
Is there a way to delete duplicate lines in a file in Unix?
I can do it with sort -u and uniq commands, but I want to use sed or awk.
Is that possible?
awk '!seen[$0]++' file.txt
seen is an associative array that AWK will pass every line of the file to. If a line isn't in the array then seen[$0] will evaluate to false. The ! is the logical NOT operator and will invert the false to true. AWK will print the lines where the expression evaluates to true.
The ++ increments seen so that seen[$0] == 1 after the first time a line is found and then seen[$0] == 2, and so on.
AWK evaluates everything but 0 and "" (empty string) to true. If a duplicate line is placed in seen then !seen[$0] will evaluate to false and the line will not be written to the output.
From http://sed.sourceforge.net/sed1line.txt:
(Please don't ask me how this works ;-) )
# delete duplicate, consecutive lines from a file (emulates "uniq").
# First line in a set of duplicate lines is kept, rest are deleted.
sed '$!N; /^\(.*\)\n\1$/!P; D'
# delete duplicate, nonconsecutive lines from a file. Beware not to
# overflow the buffer size of the hold space, or else use GNU sed.
sed -n 'G; s/\n/&&/; /^\([ -~]*\n\).*\n\1/d; s/\n//; h; P'
Perl one-liner similar to jonas's AWK solution:
perl -ne 'print if ! $x{$_}++' file
This variation removes trailing white space before comparing:
perl -lne 's/\s*$//; print if ! $x{$_}++' file
This variation edits the file in-place:
perl -i -ne 'print if ! $x{$_}++' file
This variation edits the file in-place, and makes a backup file.bak:
perl -i.bak -ne 'print if ! $x{$_}++' file
An alternative way using Vim (Vi compatible):
Delete duplicate, consecutive lines from a file:
vim -esu NONE +'g/\v^(.*)\n\1$/d' +wq
Delete duplicate, nonconsecutive and nonempty lines from a file:
vim -esu NONE +'g/\v^(.+)$\_.{-}^\1$/d' +wq
The one-liner that Andre Miller posted works except for recent versions of sed when the input file ends with a blank line and no characterss. On my Mac my CPU just spins.
This is an infinite loop if the last line is blank and doesn't have any characterss:
sed '$!N; /^\(.*\)\n\1$/!P; D'
It doesn't hang, but you lose the last line:
sed '$d;N; /^\(.*\)\n\1$/!P; D'
The explanation is at the very end of the sed FAQ:
The GNU sed maintainer felt that despite the portability problems
this would cause, changing the N command to print (rather than
delete) the pattern space was more consistent with one's intuitions
about how a command to "append the Next line" ought to behave.
Another fact favoring the change was that "{N;command;}" will
delete the last line if the file has an odd number of lines, but
print the last line if the file has an even number of lines.
To convert scripts which used the former behavior of N (deleting
the pattern space upon reaching the EOF) to scripts compatible with
all versions of sed, change a lone "N;" to "$d;N;".
The first solution is also from http://sed.sourceforge.net/sed1line.txt
$ echo -e '1\n2\n2\n3\n3\n3\n4\n4\n4\n4\n5' |sed -nr '$!N;/^(.*)\n\1$/!P;D'
1
2
3
4
5
The core idea is:
Print only once of each duplicate consecutive lines at its last appearance and use the D command to implement the loop.
Explanation:
$!N;: if the current line is not the last line, use the N command to read the next line into the pattern space.
/^(.*)\n\1$/!P: if the contents of the current pattern space is two duplicate strings separated by \n, which means the next line is the same with current line, we can not print it according to our core idea; otherwise, which means the current line is the last appearance of all of its duplicate consecutive lines. We can now use the P command to print the characters in the current pattern space until \n (\n also printed).
D: we use the D command to delete the characters in the current pattern space until \n (\n also deleted), and then the content of pattern space is the next line.
and the D command will force sed to jump to its first command $!N, but not read the next line from a file or standard input stream.
The second solution is easy to understand (from myself):
$ echo -e '1\n2\n2\n3\n3\n3\n4\n4\n4\n4\n5' |sed -nr 'p;:loop;$!N;s/^(.*)\n\1$/\1/;tloop;D'
1
2
3
4
5
The core idea is:
print only once of each duplicate consecutive lines at its first appearance and use the : command and t command to implement LOOP.
Explanation:
read a new line from the input stream or file and print it once.
use the :loop command to set a label named loop.
use N to read the next line into the pattern space.
use s/^(.*)\n\1$/\1/ to delete the current line if the next line is the same with the current line. We use the s command to do the delete action.
if the s command is executed successfully, then use the tloop command to force sed to jump to the label named loop, which will do the same loop to the next lines until there are no duplicate consecutive lines of the line which is latest printed; otherwise, use the D command to delete the line which is the same with the latest-printed line, and force sed to jump to the first command, which is the p command. The content of the current pattern space is the next new line.
uniq would be fooled by trailing spaces and tabs. In order to emulate how a human makes comparison, I am trimming all trailing spaces and tabs before comparison.
I think that the $!N; needs curly braces or else it continues, and that is the cause of the infinite loop.
I have Bash 5.0 and sed 4.7 in Ubuntu 20.10 (Groovy Gorilla). The second one-liner did not work, at the character set match.
The are three variations. The first is to eliminate adjacent repeat lines, the second to eliminate repeat lines wherever they occur, and the third to eliminate all but the last instance of lines in file.
pastebin
# First line in a set of duplicate lines is kept, rest are deleted.
# Emulate human eyes on trailing spaces and tabs by trimming those.
# Use after norepeat() to dedupe blank lines.
dedupe() {
sed -E '
$!{
N;
s/[ \t]+$//;
/^(.*)\n\1$/!P;
D;
}
';
}
# Delete duplicate, nonconsecutive lines from a file. Ignore blank
# lines. Trailing spaces and tabs are trimmed to humanize comparisons
# squeeze blank lines to one
norepeat() {
sed -n -E '
s/[ \t]+$//;
G;
/^(\n){2,}/d;
/^([^\n]+).*\n\1(\n|$)/d;
h;
P;
';
}
lastrepeat() {
sed -n -E '
s/[ \t]+$//;
/^$/{
H;
d;
};
G;
# delete previous repeated line if found
s/^([^\n]+)(.*)(\n\1(\n.*|$))/\1\2\4/;
# after searching for previous repeat, move tested last line to end
s/^([^\n]+)(\n)(.*)/\3\2\1/;
$!{
h;
d;
};
# squeeze blank lines to one
s/(\n){3,}/\n\n/g;
s/^\n//;
p;
';
}
This can be achieved using AWK.
The below line will display unique values:
awk file_name | uniq
You can output these unique values to a new file:
awk file_name | uniq > uniq_file_name
The new file uniq_file_name will contain only unique values, without any duplicates.
Use:
cat filename | sort | uniq -c | awk -F" " '$1<2 {print $2}'
It deletes the duplicate lines using AWK.