splitting a multiple FASTA file into separate files keeping their original names - awk

Question

I am trying to work with an AWK script that was posted earlier on this forum. I am trying to split a large FASTA file containing multiple DNA sequences, into separate FASTA files. I need to separate each sequence into its own FASTA file, and the name of each of the new FASTA files needs to be the name of the DNA sequence from the original, large multifasta file (all the characters after the >).
I tried this script that I found here at stackoverflow:
awk '/^>chr/ {OUT=substr($0,2) ".fa"}; OUT {print >OUT}' your_input
It works well, but the DNA sequence begins directly after the name of the file- with no space. The DNA sequence needs to begin on a new line (regular FASTA format).
I would appreciate any help to solve this.
Thank you!!

Answer 1

Do you mean something like this?
awk '/^>chr/ {OUT=substr($0,2) ".fa";print " ">OUT}; OUT{print >OUT}' your_input
where the new file that is created for each "chromosome/sequence/thing" gets a blank line at the start?

Answer 2

I think this should work.
awk '/^>chr/ {OUT=substr($0,2) ".fa"}; {print >> OUT; close(OUT)}' Input_File

Answer 3

Hope this perl script could help.
#!/usr/bin/perl
open (INFILE, "< your_input.fa")
or die "Can't open file";
while (<INFILE>) {
$line = $_;
chomp $line;
if ($line =~ /\>/) { #if has fasta >
close OUTFILE;
$new_file = substr($line,1);
$new_file .= ".fa";
open (OUTFILE, ">$new_file")
or die "Can't open: $new_file $!";
}
print OUTFILE "$line\n";
}
close OUTFILE;

Answer 4

The .fa (or .fasta) format looks like:
>ID1
SEQUENCE
>ID2
SEQUENCE
When splitting a fasta file it is actually not desired inserting a new line character at its top. Therefore the answer of Pramod is more appropriate. Additionally, the ID can be defined more generally to match only the > character. Consequently, the complete line would be:
awk '/^>/ {OUT=substr($0,2) ".fa"}; {print >> OUT; close(OUT)}' Input_File
If you don't want to mess up your current directory with all the split files you can also output into a subdirectory (subdir):
awk '/^>/ {OUT="subdir/" substr($0,2) ".fa"}; {print >> OUT; close(OUT)}' Input_File

Answer 5

awk to split multi-sequence fasta file into separate sequence files
This problem is best approached by considering each sequence (complete with header) a single record and changing awk's default record separator RS (usually a line break) to be the unique (one per record) > symbol used to define the start of a header. As we will want to use the header text as a file name, and as fasta headers cannot contain line-breaks, it is also convenient to reset awk's default field separaor FS (usually white space) to be line breaks.
Both of these are done in an awk BEGIN block:
BEGIN{RS=">";FS="\n"}
Since the file begins with >, the first record will be empty and therefore must be ignored to prevent an error caused by trying to write to a file name extracted from an empty record. Thus, the main awk action block is filtered to only process records beginning with record number (NR) 2. This is achieved by placing a condition before the action block as follows:
NR>1{ ... }
with the record separator set to > each record is a whole sequence including its header, and each is split into fields at line breaks (because we set the field separator to "\n"). Thus, field 1 ($1) of each record contains the text we wish to use as filenames. Note the record separator (>) is no longer part of any field and so the entire first field can be used to build the filename. In this example, ".fasta" has been appended as a file extension:
fnme=$1 ".fasta";
Next, the fasta header marker ">" is printed, followed by the entire record ($0) to the filename fnme just formed, using awk's > redirect:
print ">" $0 > fnme;
lastly, the file is closed to prevent awk exceeding the system limit for the number of open files allowed, if many files are to be written (see footnote):
close(fnme);
whole procedure
awk command
awk 'BEGIN{RS=">";FS="\n"} NR>1{fnme=$1".fasta"; print ">" $0 > fnme; close(fnme);}' example.fasta
Tested on the following mock file named example.fasta:
>DNA sequence 1
GCAAAAGAACCGCCGCCACTGGTCGTGAAAGTGGTCGATCCAGTGACATCCCAGGTGTTGTTAAATTGAT
CATGGGCAGTGGCGGTGTAGGCTTGAGTACTGGCTACAACAACACTCGCACTACCCGGAGTGATAGTAAT
GCCGGTGGCGGTACCATGTACGGTGGTGAAGT
>DNA sequence 2
TCCCAGCCAGCAGGTAGGGTCAAAACATGCAAGCCGGTGGCGATTCCGCCGACAGCATTCTCTGTAATTA
ATTGCTACCAGCGCGATTGGCGCCGCGACCAGGATCCTTTTTAACCATTTCAGAAAACCATTTGAGTCCA
TTTGAACCTCCATCTTTGTTC
>DNA sequence 3
AACAAAAGAATTAGAGATATTTAACTCCACATTATTAAACTTGTCAATAACTATTTTTAACTTACCAGAA
AATTTCAGAATCGTTGCGAAAAATCTTGGGTATATTCAACACTGCCTGTATAACGAAACACAATAGTACT
TTAGGCTAACTAAGAAAAAACTTT
results (terminal commands and output)
$ ls
'DNA sequence 1.fasta' 'DNA sequence 3.fasta'
'DNA sequence 2.fasta' example.fasta
$ cat DNA\ sequence\ 1.fasta
>DNA sequence 1
GCAAAAGAACCGCCGCCACTGGTCGTGAAAGTGGTCGATCCAGTGACATCCCAGGTGTTGTTAAATTGAT
CATGGGCAGTGGCGGTGTAGGCTTGAGTACTGGCTACAACAACACTCGCACTACCCGGAGTGATAGTAAT
GCCGGTGGCGGTACCATGTACGGTGGTGAAGT
$ cat DNA\ sequence\ 2.fasta
>DNA sequence 2
TCCCAGCCAGCAGGTAGGGTCAAAACATGCAAGCCGGTGGCGATTCCGCCGACAGCATTCTCTGTAATTA
ATTGCTACCAGCGCGATTGGCGCCGCGACCAGGATCCTTTTTAACCATTTCAGAAAACCATTTGAGTCCA
TTTGAACCTCCATCTTTGTTC
$ cat DNA\ sequence\ 3.fasta
>DNA sequence 3
AACAAAAGAATTAGAGATATTTAACTCCACATTATTAAACTTGTCAATAACTATTTTTAACTTACCAGAA
AATTTCAGAATCGTTGCGAAAAATCTTGGGTATATTCAACACTGCCTGTATAACGAAACACAATAGTACT
TTAGGCTAACTAAGAAAAAACTTT
footnote
"To write numerous files, successively, in the same awk program. If the files aren’t closed, eventually awk may exceed a system limit on the number of open files in one process. It is best to close each one when the program has finished writing it."
quoted from https://www.gnu.org/software/gawk/manual/html_node/Close-Files-And-Pipes.html