I have an input file file the content of which constantly is updated
with various number of fields, what I am trying to is to print out to a new file
the next to last field of each line of input file:
awk '{print $(NF-1)}' outputfile
error:
and
awk: (FILENAME=- FNR=2) fatal: attempt to access field -1
Need help. Thanks in advance
On lines with no fields (blank lines, or all whitespace) NF is 0, so that evaluates to $(-1). Also if there's only one field your code will print $0 which may not be what you want.
awk 'NF>=2 {print $(NF-1)}'
Should be awk 'NF > 1 { print $(NF - 1); }'
awk 'NF { print $(NF - 1) }' is not correct. When NF == 1 it'll print $0 which is not next to the last field.
another awk line: (golfing a bit):
awk 'NF>1&&$0=$(NF-1)'
Related
I have the following csv file
238013750030646-2;;"Default";"2020-10-01 00:40:36";;"opening";0;3591911;283940640
238013750030646-2;;"Default";"2020-10-03 00:40:36";;"closing line";0;89320;283940640
238013750030646-2;;"something-else";"2020-10-04 00:40:36";;"started";0;0;283940640
238013750030646-2;;"default else";"2020-10-08 05:42:06";;"opening";0;2410;283940640
Im trying to store each line in a specific file matching the date from each line, with the date being in the 4th column of each line, so first line ("2020-10-01 00:40:36") should be in output-01.csv, second line in output-03.csv etc
This awk command
awk -F";|-" -vOFS='\t' '{print > "output-"$7".csv"}' testing.csv
half works but fails on line 3 because of the - in the 3rd column, and line 4 because of the in the 3rd column - this produces output-10.csv
Is there a way to run the awk command twice ? then i could extract the date using the ; separator and then split using -
Using gawk takes care of unsorted file too :
awk 'match($0,/([0-9]{4})-([0-9]{2})-([0-9]{2})/,arr){
file=sprintf("output-%s.csv",arr[3]);
if(!seen[file]++){
print >file;
next
}
}{
print >>file;
close(file);
}' infile
Explanation:
awk 'match($0,/([0-9]{4})-([0-9]{2})-([0-9]{2})/,arr){ # match for regex
file=sprintf("output-%s.csv",arr[3]); # file variable using array arr value, 3rd index
if(!seen[file]++){ # if not seen file name before in array seen
print >file; # print content to file
next # go to next line
}
}{
print >>file; # append content to file
close(file); # close file
}' infile
Try this:
$ awk -F';' -v OFS='\t' '{split($4,a,/[- ]/); file = "output-"a[3]".csv";
$1=$1; print > file; close(file)}' testing.csv
split($4,a,/[- ]/) this will split 4th field further based on space or - characters, saved in array a
file = "output-"a[3]".csv" output filename
$1=$1 since there's no other command changing contents of input line, this is needed to rebuild input line, otherwise OFS will not be applied
print > file print input line to required file
close(file) calling close, useful if there are too many file names
You can also use file = "output-" substr($4,10,2) ".csv" instead of split if the 4th column is consistent as shown in the sample.
With your shown samples, please try following, written and tested in GNU awk.
awk '
match($0,/[0-9]{4}(-[0-9]{2}){2}/){
outputFile=substr($0,RSTART+8,RLENGTH-8)".csv"
print >> (outputFile)
close(outputFile)
}
' Input_file
Explanation: Adding detailed explanation for above.
awk ' ##Starting awk program from here.
match($0,/[0-9]{4}(-[0-9]{2}){2}/){ ##using match function to match yyyy-mm-dd here in line.
outputFile=substr($0,RSTART+8,RLENGTH-8)".csv" ##Getting matched regex sub-string into outputFile here.
print >> (outputFile) ##Printing current line into outputFile here.
close(outputFile) ##Closing output file to avoid too many files opened error.
}
' Input_file ##Mentioning Input_file name here.
To do this efficiently you should sort on the key field first:
awk -F';' '{print $4, NR, $0}' file |
sort -k1,1 -k3,3n |
awk '
{ curr=$1; sub(/([^ ]+ ){2}/,"") }
curr != prev { close(out); out="output-" (++c) ".csv"; prev=curr }
{ print > out }
'
$ head output*.csv
==> output-1.csv <==
238013750030646-2;;"Default";"2020-10-01 00:40:36";;"opening";0;3591911;283940640
==> output-2.csv <==
238013750030646-2;;"Default";"2020-10-03 00:40:36";;"closing line";0;89320;283940640
==> output-3.csv <==
238013750030646-2;;"something-else";"2020-10-04 00:40:36";;"started";0;0;283940640
==> output-4.csv <==
238013750030646-2;;"default else";"2020-10-08 05:42:06";;"opening";0;2410;283940640
The above will work using any awk+sort in any shell on every Unix box. See the many similar examples on this site for an explanation.
I'd like to print the word on the second column of the second line of a file, only if it ends in .local.
How can I achieve this using awk?
Right now I have awk 'FNR==2{print $2}', but this prints the word no matter what.
Adding a check for $2 against RE:
awk 'FNR == 2 && $2 ~ /\.local$/ { print $2 }'
Here is my input file
>OTU1;size=4;
ATTCCGGGTTTACT
ATTCCTTTTATCGA
ATC
>OTU2;size=10;
CGGATCTAGGCGAT
ACT
>OTU3;size=5;
ATTCCCGGGATCTA
ACTTTTC
The expected output file is:
>OTU1;size=4;ATTCCGGGTTTACTATTCCTTTTATCGAATC
>OTU2;size=10;CGGATCTAGGCGATACT
>OTU3;size=5;ATTCCCGGGATCTAACTTTTC
I've tried the code from Remove line breaks in a FASTA file
but this doesn't work for me, and I am not sure how to modify the code from that post...
Any suggestion? Thanks in advance!
Here is another awk script. Using the awk internal parsing mechanism.
awk 'BEGIN{RS=">";OFS="";}NR>1{$1=$1;print ">"$0}' input.txt
Output is:
>OTU1;size=4;ATTCCGGGTTTACTATTCCTTTTATCGAATC
>OTU2;size=10;CGGATCTAGGCGATACT
>OTU3;size=5;ATTCCCGGGATCTAACTTTTC
Explanation:
awk '
BEGIN { # initialize awk internal variables
RS=">"; # set `RS`=record separator to `>`
OFS=""; # set `OFS`=output field separator to empty string.
}
NR>1 { # handle from 2nd record (1st record is empty).
$1=$1; # regenerate the output line
print ">"$0 # print out ">" with computed output line
}' input.txt
$ awk '{printf "%s%s", (/^>/ ? ors : ""), $0; ors=ORS} END{print ""}' file
>OTU1;size=4;ATTCCGGGTTTACTATTCCTTTTATCGAATC
>OTU2;size=10;CGGATCTAGGCGATACT
>OTU3;size=5;ATTCCCGGGATCTAACTTTTC
Could you please try following too.
awk -v RS=">" 'NR>1{gsub(/\n/,"");print ">"$0}' Input_file
My original attempt was awk -v RS=">" -v FS="\n" -v OFS="" 'NF>1{$1=$1;print ">"$0}' Input_file but later I saw it is already answered buy dudi boy so written another(first mentioned) one.
Similar to my answer here:
$ awk 'BEGIN{RS=">"; FS="\n"; ORS=""}
(FNR==1){next}
{ name=$1; seq=$0; gsub(/(^[^\n]*|)\n/,"",seq) }
{ print ">" name seq }' file1.fasta file2.fasta file3.fasta ...
I would like to modify a file by including the size of following line using awk.
My file is like this:
>AAAS:1220136:1220159:-:0::NW_015494524.1:1220136-1220159(-)
ATGTCGATGCTCGATC
>AAAS::1215902:1215986:-:1::NW_015494524.1:1215902-1215986(-)
ATGCGATGCTAGCTAGCTCGAT
>AAAS:1215614:1215701:-:1::NW_015494524.1:1215614-1215701(-)
ATGCCGCGACGCAGCACCCGACGCGCAG
I am using awk to modify it to have the following format:
>Assembly_AAAS_1_16
ATGTCGATGCTCGATC
>Assembly_AAAS_2_22
ATGCGATGCTAGCTAGCTCGAT
>Assembly_AAAS_3_28
ATGCCGCGACGCAGCACCCGACGCGCAG
I have used awk to modify the first part.
awk -F":" -v i=1 '/>/{print ">Assembly_" $1 "_" val i "_";i++;next} {print length($0)} 1' infile | sed -e "s/_>/_/g" > outfile
I can use print length($0) but how to print it in the same line?
Thanks
EDIT2: Since OP has changed the sample data again so adding this code now.
awk -v val="Assembly_AAAS_" '/>/{++i;val=">"val i "_";next} {sub(/ +$/,"");print val length($0) ORS $0}' Input_file
OR
awk -v val="Assembly_AAAS_" '/>/{++i;val=">"val i "_";next} {print val length($1) ORS $0;}' Input_file
Above will remove spaces from last of the lines of Input_file, in case you don't need it then remove sub(/ +$/,""); part from above code please.
EDIT: As per OP changed solution now.
awk -v i=1 -v val=">Assembly_GeneName1_" -v val1="_sizeline" '/>/{value="\047" val i val1;i++;next} {print value length($0) ORS $0}' Input_file
OR
awk -v i=1 -v val=">Assembly_GeneName1_" -v val1="_sizeline" '
/>/{ value="\047" val i val1;
i++;
next}
{
print value length($0) ORS $0
}
' Input_file
Following awk may help you on same.
awk -v i="" -v j=2 '/>/{print "\047>Assembly_GeneName1_"++i"_sizeline"j;j+=2;next} 1' Input_file
Solution 2nd:
awk -v i=1 -v j=2 -v val=">Assembly_GeneName1_" -v val1="_sizeline" '/>/{print "\047" val i val1 j;j+=2;i++;next} 1' Input_file
What you are dealing with is a beautiful example of records which are not lines. awk is a record parser and by default, a record is defined to be a line. With awk you can define a record to be a block of text using the record separator RS.
RS : The first character of the string value of RS shall be the input record separator; a <newline> by default. If RS contains more
than one character, the results are unspecified. If RS is null, then
records are separated by sequences consisting of a <newline> plus one
or more blank lines, leading or trailing blank lines shall not result
in empty records at the beginning or end of the input, and a <newline>
shall always be a field separator, no matter what the value of FS is.
So the goal is to define the record to be
AAAS:1220136:1220159:-:0::NW_015494524.1:1220136-1220159(-)
ATGTCGATGCTCGATC
And this can be done by defining the RS="\n<". Furthremore we will use \n as a field separator FS. This way you can get the requested length as length($2) and the count by using the record count NR.
A simple awk script is then:
awk 'BEGIN{RS="\n<"; FS=OFS="\n"}
{$1=">Assembly_AAAS_"NR"_"length($2)}
{print $1,$2}' <file>
This will do exactly what you want.
note: we use print $1,$2 and not print $0 as the last record might have 3 fields (if the last char of the file is a newline). This would imply that you would have an extra empty line at the end of your file.
If you want to pick the AAAS string out of $1 you can use substr($1,1,match($1,":")-1) to pick it up. This results in this:
awk 'BEGIN{RS="\n<"; FS=OFS="\n"}
{$1=">Assembly_"substr($1,1,match($1,":")-1)"_"NR"_"length($2)}
{print $1,$2}' <file>
Finally, be aware that the above solution only works if there are no spaces in $2, if you want to change that, you can do this :
awk 'BEGIN{RS="\n<"; FS=OFS="\n"}
{ gsub(/[[:blank:]]/,"",$2);
$1=">Assembly_"substr($1,1,match($1,":")-1)"_"NR"_"length($2)
}
{ print $1,$2 }' <file>
I want to modify lines in a file using awk and print the new lines with the following line.
My file is like this
Name_Name2_ Name3_Name4
ASHRGSJFSJRGDJRG
Name5_Name6_Name7_Name8
ADGTHEGHGTJKLGRTIWRK
I want
Name-Name2
ASHRGSJFSJRGDJRG
Name5-Name6
ADGTHEGHGTJKLGRTIWRK
I have sued awk to modify my file:
awk -F'_' {print $1 "-" $2} file > newfile
but I don't know how to tell to print also the line just after (ABDJRH)
sure is it possible with awk x=NR+1 NR<=x
thanks
Following awk may help you on same.
awk -F"_" '/_/{print $1"-"$2;next} 1' Input_file
assuming your structure in sample (no separation in line with "data" letter )
awk '$0=$1' Input_file
# or with sed
sed 's/[[:space:]].*//' Input_file