array over non-existing indices in awk - awk

Sorry for the verbose question, it boils down to a very simple problem.
Assume there are n text files each containing one column of strings (denominating groups) and one of integers (denominating the values of instances within these groups):
# filename xxyz.log
a 5
a 6
b 10
b 15
c 101
c 100
#filename xyzz.log
a 3
a 5
c 116
c 128
Note that while the length of both columns within any given file is always identical it differs between files. Furthermore, not all files contain the same range of groups (the first one contains groups a, b, c, while the second one only contains groups a and c). In awk one could calculate the average of column 2 for each string in column 1 within each file separately and output the results with the following code:
NAMES=$(ls|grep .log|awk -F'.' '{print $1}');
for q in $NAMES;
do
gawk -F' ' -v y=$q 'BEGIN {print "param", y}
{sum1[$1] += $2; N[$1]++}
END {for (key in sum1) {
avg1 = sum1[key] / N[key];
printf "%s %f\n", key, avg1;
} }' $q.log | sort > $q.mean;
done;
Howerver, for the abovementioned reasons, the length of the resulting .mean files differs between files. For each .log file I'd like to output a .mean file listing the entire range of groups (a-d) in the first column and the corresponding mean value or empty spaces in the second column depending on whether this category is present in the .log file. I've tried the following code (given without $NAMES for brevity):
awk 'BEGIN{arr[a]="a"; arr[b]="b"; arr[c]="c"; arr[d]="d"}
{sum[$1] += $2; N[$1]++}
END {for (i in arr) {
if (i in sum) {
avg = sum[i] / N[i];
printf "%s %f\n" i, avg;}
else {
printf "%s %s\n" i, "";}
}}' xxyz.log > xxyz.mean;
but it returns the following error:
awk: (FILENAME=myfile FNR=7) fatal: not enough arguments to satisfy format string
`%s %s
'
^ ran out for this one
Any suggestions would be highly appreciated.

Will you ever have explicit zeroes or negative numbers in the log files? I'm going to assume not.
The first line of your second script doesn't do what you wanted:
awk 'BEGIN{arr[a]="a"; arr[b]="b"; arr[c]="c"; arr[d]="d"}
This assigns "a" to arr[0] (because a is a variable not previously used), then "b" to the same element (because b is a variable not previously used), then "c", then "d". Clearly, not what you had in mind. This (untested) code should do the job you need as long as you know that there are just the four groups. If you don't know the groups a priori, you need a more complex program (it can be done, but it is harder).
awk 'BEGIN { sum["a"] = 0; sum["b"] = 0; sum["c"] = 0; sum["d"] = 0 }
{ sum[$1] += $2; N[$1]++ }
END { for (i in sum) {
if (N[i] == 0) N[i] = 1 # Divide by zero protection
avg = sum[i] / N[i];
printf "%s %f\n" i, avg;
}
}' xxyz.log > xxyz.mean;
This will print a zero average for the missing groups. If you prefer, you can do:
awk 'BEGIN { sum["a"] = 0; sum["b"] = 0; sum["c"] = 0; sum["d"] = 0 }
{ sum[$1] += $2; N[$1]++ }
END { for (i in sum) {
if (N[i] == 0)
printf("%s\n", i;
else {
avg = sum[i] / N[i];
printf "%s %f\n" i, avg;
}
}
}' xxyz.log > xxyz.mean;

For each .log file I'd like to output a .mean file listing the entire
range of groups (a-d) in the first column and the corresponding mean
value or empty spaces in the second column depending on whether this
category is present in the .log file.
Not purely an awk solution, but you can get all the groups with this.
awk '{print $1}' *.log | sort -u > groups
After you calculate the means, you can then join the groups file. Let's say the means for your second input file look like this temporary, intermediate file. (I called it xyzz.tmp.)
a 4
c 122
Join the groups, preserving all the values from the groups file.
$ join -a1 groups xyzz.tmp > xyzz.mean
$ cat xyzz.mean
a 4
b
c 122

Here's my take on the problem. Run like:
./script.sh
Contents of script.sh:
array=($(awk '!a[$1]++ { print $1 }' *.log))
readarray -t sorted < <(for i in "${array[#]}"; do echo "$i"; done | sort)
for i in *.log; do
for j in "${sorted[#]}"; do
awk -v var=$j '
{
sum[$1]+=$2
cnt[$1]++
}
END {
print var, (var in cnt ? sum[var]/cnt[var] : "")
}
' "$i" >> "${i/.log/.main}"
done
done
Results of grep . *.main:
xxyz.main:a 5.5
xxyz.main:b 12.5
xxyz.main:c 100.5
xyzz.main:a 4
xyzz.main:b
xyzz.main:c 122

Here is a pure awk answer:
find . -maxdepth 1 -name "*.log" -print0 |
xargs -0 awk '{SUBSEP=" ";sum[FILENAME,$1]+=$2;cnt[FILENAME,$1]+=1;next}
END{for(i in sum)print i, sum[i], cnt[i], sum[i]/cnt[i]}'
Easy enough to push this into a file --

Related

extract info from a tag using awk

I have multi columns file and i want to extract some info in column 71.
I want to extract using tags which the value can be anything, for example i want to just extract AC=* ; AF=* , where the value can be anything .
I found similar question and gave it a try but it didn't work
Extract columns with values matching a specific pattern
Column 71 looks like this:
AC=14511;AC_AFR=382;AC_AMR=1177;AC_Adj=14343;AC_EAS=5;AC_FIN=427;AC_Het=11813;AC_Hom=1265;AC_NFE=11027;AC_OTH=97;AC_SAS=1228;AF=0.137;AN=106198;AN_AFR=8190;AN_AMR=10424;AN_Adj=99264;AN_EAS=7068;AN_FIN=6414;AN_NFE=51090;AN_OTH=658;AN_SAS=15420;BaseQRankSum=1.73;ClippingRankSum=-1.460e-01;DB;DP=1268322;FS=0.000;GQ_MEAN=190.24;GQ_STDDEV=319.67;Het_AFR=358;Het_AMR=1049;Het_EAS=5;Het_FIN=399;Het_NFE=8799;Het_OTH=83;Het_SAS=1120;Hom_AFR=12;Hom_AMR=64;Hom_EAS=0;Hom_FIN=14;Hom_NFE=1114;Hom_OTH=7;Hom_SAS=54;InbreedingCoeff=0.0478;MQ=60.00;MQ0=0;MQRankSum=0.037;NCC=270;POSITIVE_TRAIN_SITE;QD=21.41;ReadPosRankSum=0.212;VQSLOD=4.79;culprit=MQ;DP_HIST=30|3209|1539|1494|30007|7938|4130|2038|1310|612|334|185|97|60|31|25|9|11|7|33,0|66|339|1048|2096|2665|2626|1832|1210|584|323|179|89|54|31|22|7|9|4|15;GQ_HIST=84|66|56|82|3299|568|617|403|250|319|436|310|28566|2937|827|834|451|186|217|12591,15|15|13|16|25|11|22|28|18|38|52|31|65|76|39|83|93|65|97|12397;CSQ=T|ENSG00000186868|ENST00000334239|Transcript|intron_variant||||||rs754512|1||1|MAPT|HGNC|6893|protein_coding||CCDS11502.1|ENSP00000334886|TAU_HUMAN|B4DSE3_HUMAN|UPI0000000C16||||2/8||ENST00000334239.8:c.134-94A>T||T:0.1171|||||||||15792962||||||||,T|ENSG00000186868|ENST00000570299|Transcript|intron_variant&non_coding_transcript_variant||||||rs754512|1||1|MAPT|HGNC|6893|processed_transcript||||||||||2/6||ENST00000570299.1:n.262-94A>T||T:0.1171|||||||||15792962||||||||,T|ENSG00000186868|ENST00000340799|Transcript|intron_variant||||||rs754512|1||1|MAPT|HGNC|6893|protein_coding||CCDS45716.1|ENSP00000340438|TAU_HUMAN||UPI000004EEE6||||3/10||ENST00000340799.5:c.221-94A>T||T:0.1171|||||||||15792962||||||||,T|ENSG00000186868|ENST00000262410|Transcript|intron_variant||||||rs754512|1||1|MAPT|HGNC|6893|protein_coding||CCDS11501.1|ENSP00000262410|TAU_HUMAN||UPI0000EE80B7||||4/13||ENST00000262410.5:c.308-94A>T||T:0.1171|||||||||15792962||||||||,T|ENSG00000186868|ENST00000446361|Transcript|intron_variant||||||rs754512|1||1|MAPT|HGNC|6893|protein_coding||CCDS11500.1|ENSP00000408975|TAU_HUMAN||UPI000004EEE5||||2/9||ENST00000446361.3:c.134-94A>T||T:0.1171|||||||||15792962||||||||,T|ENSG00000186868|ENST00000574436|Transcript|intron_variant||||||rs754512|1||1|MAPT|HGNC|6893|protein_coding||CCDS11499.1|ENSP00000460965|TAU_HUMAN||UPI000002D754||||3/10||ENST00000574436.1:c.308-94A>T||T:0.1171|||||||||15792962||||||||,T|ENSG00000186868|ENST00000571987|Transcript|intron_variant||||||rs754512|1||1|MAPT|HGNC|6893|protein_coding||CCDS11501.1|ENSP00000458742|TAU_HUMAN||UPI0000EE80B7||||3/12||ENST00000571987.1:c.308-94A>T||T:0.1171|||||||||15792962||||||||,T|ENSG00000186868|ENST00000415613|Transcript|intron_variant||||||rs754512|1||1|MAPT|HGNC|6893|protein_coding||CCDS45715.1|ENSP00000410838|TAU_HUMAN||UPI0001AE66E9||||3/13||ENST00000415613.2:c.308-94A>T||T:0.1171|||||||||15792962||||||||,T|ENSG00000186868|ENST00000571311|Transcript|intron_variant&NMD_transcript_variant||||||rs754512|1||1|MAPT|HGNC|6893|nonsense_mediated_decay|||ENSP00000460048||I3L2Z2_HUMAN|UPI00025A2E6E||||4/4||ENST00000571311.1:c.*176-94A>T||T:0.1171|||||||||15792962||||||||,T|ENSG00000186868|ENST00000535772|Transcript|intron_variant||||||rs754512|1||1|MAPT|HGNC|6893|protein_coding||CCDS56033.1|ENSP00000443028|TAU_HUMAN|B4DSE3_HUMAN|UPI000004EEE4||||4/10||ENST00000535772.1:c.308-94A>T||T:0.1171|||||||||15792962||||||||,T|ENSG00000186868|ENST00000576518|Transcript|stop_gained|5499|7|3|K/*|Aag/Tag|rs754512|1||1|MAPT|HGNC|6893|protein_coding|||ENSP00000458621||I3L170_HUMAN&B4DSE3_HUMAN|UPI0001639A7C|||1/7|||ENST00000576518.1:c.7A>T|ENSP00000458621.1:p.Lys3Ter|T:0.1171|||||||||15792962|||||POSITION:0.00682261208576998&ANN_ORF:-255.6993&MAX_ORF:-255.6993|PHYLOCSF_WEAK|ANC_ALLELE|LC,T|ENSG00000186868|ENST00000420682|Transcript|intron_variant||||||rs754512|1||1|MAPT|HGNC|6893|protein_coding||CCDS45716.1|ENSP00000413056|TAU_HUMAN||UPI000004EEE6||||2/9||ENST00000420682.2:c.221-94A>T||T:0.1171|||||||||15792962||||||||,T|ENSG00000186868|ENST00000572440|Transcript|non_coding_transcript_exon_variant&non_coding_transcript_variant|2790|||||rs754512|1||1|MAPT|HGNC|6893|retained_intron|||||||||1/1|||ENST00000572440.1:n.2790A>T||T:0.1171|||||||||15792962||||||||,T|ENSG00000186868|ENST00000351559|Transcript|intron_variant||||||rs754512|1||1|MAPT|HGNC|6893|protein_coding||CCDS11499.1|ENSP00000303214|TAU_HUMAN||UPI000002D754||||4/11||ENST00000351559.5:c.308-94A>T||T:0.1171|||||||||15792962||||||||,T|ENSG00000186868|ENST00000344290|Transcript|intron_variant||||||rs754512|1||1|MAPT|HGNC|6893|protein_coding|YES|CCDS45715.1|ENSP00000340820|TAU_HUMAN||UPI0001AE66E9||||4/14||ENST00000344290.5:c.308-94A>T||T:0.1171|||||||||15792962||||||||,T|ENSG00000186868|ENST00000347967|Transcript|intron_variant||||||rs754512|1||1|MAPT|HGNC|6893|protein_coding|||ENSP00000302706|TAU_HUMAN|B4DSE3_HUMAN|UPI0000173D91||||4/10||ENST00000347967.5:c.32-100A>T||T:0.1171|||||||||15792962||||||||,T|ENSG00000186868|ENST00000431008|Transcript|intron_variant||||||rs754512|1||1|MAPT|HGNC|6893|protein_coding||CCDS56033.1|ENSP00000389250|TAU_HUMAN|B4DSE3_HUMAN|UPI000004EEE4||||3/9||ENST00000431008.3:c.308-94A>T||T:0.1171|||||||||15792962||||||||
The code that i tried:
awk '{
for (i = 1; i <= NF; i++) {
if ($i ~ /AC|AF/) {
printf "%s %s ", $i, $(i + 1)
}
}
print ""
}'
I keep getting syntax error.
output wanted :
AC=14511;AF=0.137
Whenever you have name=value pairs, it's usually simplest to first create an array that maps names to values (n2v[] below) and then you can just access the values by their names.
$ cat file
AC=1;AC_AFR=2;AF=3 AC=4;AC_AFR=5;AF=6
$ cat tst.awk
{
delete n2v
split($2,tmp,/[;=]/)
for (i=1; i in tmp; i+=2) {
n2v[tmp[i]] = tmp[i+1]
}
prt("AC")
prt("AF")
}
function prt(name) { print name, "=", n2v[name] }
$ awk -f tst.awk file
AC = 4
AF = 6
Just change $2 to $71 for your real input.
Something like this should do it (in Gnu awk due to switch):
$ awk '{split($71,a,";");for(i in a )if(a[i]~/^AF/) print a[i]}' foo
AF=0.137
You split the field $71 by ;s, loop thru the array you split to looking for desired match. For multiple matches use switch:
$ awk '{
split($0,a,";");
for(i in a )
switch(a[i]) {
case /^AF=/:
b=b a[i] OFS;
break;
case /^AC=/:
b=b a[i] OFS;
break
}
sub(/.$/,"\n",b);
printf b
}' foo
AC=14511 AF=0.137
EDIT: Now it buffers output to a variable and prints it in the end. You can control the separator with OFS.

Awk average of n data in each column

"Using awk to bin values in a list of numbers" provide a solution to average each set of 3 points in a column using awk.
How is it possible to extend it to an indefinite number of columns mantaining the format? For example:
2457135.564106 13.249116 13.140903 0.003615 0.003440
2457135.564604 13.250833 13.139971 0.003619 0.003438
2457135.565067 13.247932 13.135975 0.003614 0.003432
2457135.565576 13.256441 13.146996 0.003628 0.003449
2457135.566039 13.266003 13.159108 0.003644 0.003469
2457135.566514 13.271724 13.163555 0.003654 0.003476
2457135.567011 13.276248 13.166179 0.003661 0.003480
2457135.567474 13.274198 13.165396 0.003658 0.003479
2457135.567983 13.267855 13.156620 0.003647 0.003465
2457135.568446 13.263761 13.152515 0.003640 0.003458
averaging values every 5 lines, should output something like
2457135.564916 13.253240 13.143976 0.003622 0.003444
2457135.567324 13.270918 13.161303 0.003652 0.003472
where the first result is the average of the first 1-5 lines, and the second result is the average of the 6-10 lines.
The accepted answer to Using awk to bin values in a list of numbers is:
awk '{sum+=$1} NR%3==0 {print sum/3; sum=0}' inFile
The obvious extension to average all the columns is:
awk 'BEGIN { N = 3 }
{ for (i = 1; i <= NF; i++) sum[i] += $i }
NR % N == 0 { for (i = 1; i <= NF; i++)
{
printf("%.6f%s", sum[i]/N, (i == NF) ? "\n" : " ")
sum[i] = 0
}
}' inFile
The extra flexibility here is that if you want to group blocks of 5 rows, you simply change one occurrence of 3 into 5. This ignores blocks of up to N-1 rows at the end of the file. If you want to, you can add an END block that prints a suitable average if NR % N != 0.
For the sample input data, the output I got from the script above was:
2457135.564592 13.249294 13.138950 0.003616 0.003437
2457135.566043 13.264723 13.156553 0.003642 0.003465
2457135.567489 13.272767 13.162732 0.003655 0.003475
You can make the code much more complex if you want to analyze what the output formats should be. I've simply used %.6f to ensure 6 decimal places.
If you want N to be a command-line parameter, you can use the -v option to relay the variable setting to awk:
awk -v N="${variable:-3}" \
'{ for (i = 1; i <= NF; i++) sum[i] += $i }
NR % N == 0 { for (i = 1; i <= NF; i++)
{
printf("%.6f%s", sum[i]/N, (i == NF) ? "\n" : " ")
sum[i] = 0
}
}' inFile
When invoked with $variable set to 5, the output generated from the sample data is:
2457135.565078 13.254065 13.144591 0.003624 0.003446
2457135.567486 13.270757 13.160853 0.003652 0.003472

Finding common elements among all lines of a text file

I have a text file like:
a b c d e
b c e
d f g e h c
I am looking for a simple AWK which can output the common elements among all lines ignoring their first element. The desired output is:
c e
or
e c
$ cat tst.awk
FNR==1 { for (i=1; i<=NF; i++) common[$i]; next }
{
for (c in common) {
present = 0
for (i=1; i<=NF; i++) {
if ($i == c) {
present = 1
}
}
if (!present) {
delete common[c]
}
}
}
END {
i=0
for (c in common) {
printf "%s%s", (++i>1?OFS:""), c
}
print ""
}
$ awk -f tst.awk file
c e
If you really want to skip the first char on each line, just change the 2 for (i=1; i<=NF; i++) loops to start at 2 instead of 1.
Although the above was accepted I actually prefer #jaypal's approach (but not his choice of tool :-) ), so here's the awk equivalent:
$ cat tst.awk
{ delete seen; for (i=1; i<=NF; i++) if (!seen[$i]++) count[$i]++ }
END {
i=0
for (c in count)
if (count[c] == NR)
printf "%s%s", (++i>1?OFS:""), c
print ""
}
$
$ awk -f tst.awk file
c e
If your awk doesn't support delete seen, change it to split("",seen).
perl to the rescue:
perl -lane '
my %seen;
map { $total{$F[$_]}++ unless $seen{$F[$_]}++ } 1 .. $#F;
}{
print join " ", grep { $total{$_} == $. } keys %total
' file
e c
Keep a rolling %total hash which will increment the elements only if they are unique for every line. %seen is a hash that helps keep track of those elements. Hence we use my declaration to reset it for every line.
In the END block we just grep those elements whose value meets the total number of lines as that would mean they were seen on every line.
The command line options are:
-l: Chomps the newline and places it back during print.
-a: Splits the line on whitespace and loads an array #F with those values.
-n: Creates a while(<>) { .. } loop to process every line.
-e: Executes the code block thats follows in quotes.
Another perl approach:
perl -lane '
if ($. == 1) { %intersect = map {$_ => 1} #F; next }
%intersect = map {$_ => 1} grep {$intersect{$_}} #F;
END {print join " ", keys %intersect}
' file
Results will not be in any particular order.

Awk merge the results of processing two files into a single file

I use awk to extract and calculate information from two different files and I want to merge the results into a single file in columns ( for example, the output of first file in columns 1 and 2 and the output of the second one in 3 and 4 ).
The input files contain:
file1
SRR513804.1218581HWI-ST695_116193610:4:1307:17513:49120 SRR513804.16872HWI ST695_116193610:4:1101:7150:72196 SRR513804.2106179HWI-
ST695_116193610:4:2206:10596:165949 SRR513804.1710546HWI-ST695_116193610:4:2107:13906:128004 SRR513804.544253
file2
>SRR513804.1218581HWI-ST695_116193610:4:1307:17513:49120
TTTTGTTTTTTCTATATTTGAAAAAGAAATATGAAAACTTCATTTATATTTTCCACAAAG
AATGATTCAGCATCCTTCAAAGAAATTCAATATGTATAAAACGGTAATTCTAAATTTTAT
ACATATTGAATTTCTTTGAAGGATGCTGAATCATTCTTTGTGGAAAATATAAATGAAGTT
TTCATATTTCTTTTTCAAAT
To parse the first file I do this:
awk '
{
s = NF
center = $1
}
{
printf "%s\t %d\n", center, s
}
' file1
To parse the second file I do this:
awk '
/^>/ {
if (count != "")
printf "%s\t %d\n", seq_id, count
count = 0
seq_id = $0
next
}
NF {
long = length($0)
count = count+long
}
END{
if (count != "")
printf "%s\t %d\n", seq_id, count
}
' file2
My provisional solution is create one temporal and overwrite in the second step. There is a more "elegant" way to get this output?
I am not fully clear on the requirement and if you can update the question may be we can help improvise the answer. However, from what I have gathered is that you would like to summarize the output from both files. I have made an assumption that content in both files are in sequential order. If that is not the case, then we will have to add additional checks while printing the summary.
Content of script.awk (re-using most of your existing code):
NR==FNR {
s[NR] = NF
center[NR] = $1
next
}
/^>/ {
seq_id[++y] = $0
++i
next
}
NF {
long[i] += length($0)
}
END {
for(x=1;x<=length(s);x++) {
printf "%s\t %d\t %d\n", center[x], s[x], long[x]
}
}
Test:
$ cat file1
SRR513804.1218581HWI-ST695_116193610:4:1307:17513:49120 SRR513804.16872HWI ST695_116193610:4:1101:7150:72196 SRR513804.2106179HWI-
ST695_116193610:4:2206:10596:165949 SRR513804.1710546HWI-ST695_116193610:4:2107:13906:128004 SRR513804.544253
$ cat file2
>SRR513804.1218581HWI-ST695_116193610:4:1307:17513:49120
TTTTGTTTTTTCTATATTTGAAAAAGAAATATGAAAACTTCATTTATATTTTCCACAAAG
AATGATTCAGCATCCTTCAAAGAAATTCAATATGTATAAAACGGTAATTCTAAATTTTAT
ACATATTGAATTTCTTTGAAGGATGCTGAATCATTCTTTGTGGAAAATATAAATGAAGTT
TTCATATTTCTTTTTCAAAT
$ awk -f script.awk file1 file2
SRR513804.1218581HWI-ST695_116193610:4:1307:17513:49120 4 200
ST695_116193610:4:2206:10596:165949 3 0

How to print specific duplicate line based on fields number

I need to print out only one of various consecutive lines with same first field, and the one must be the one with "more fields in its last field". That means that last field is a set of words, and I need to print the line with more elements in its last field. In case of same number of max elements in last field, any of the max is ok.
Example input:
("aborrecimento",[Noun],[Masc],[Reg:Sing],[Bulk])
("aborrecimento",[Noun],[Masc],[Reg:Sing],[Device,Concrete,Count])
("aborrecimento",[Noun],[Masc],[Reg:Sing],[])
("adiamento",[Noun],[Masc],[Reg:Sing],[])
("adiamento",[Noun],[Masc],[Reg:Sing],[Count])
("adiamento",[Noun],[Masc],[Reg:Sing],[VerbNom])
Example output:
("aborrecimento",[Noun],[Masc],[Reg:Sing],[Device,Concrete,Count])
("adiamento",[Noun],[Masc],[Reg:Sing],[VerbNom])
solution with awk would be nice, but no need of one liner.
generate index file
$ cat input.txt |
sed 's/,\[/|[/g' |
awk -F'|' '
{if(!gensub(/[[\])]/, "", "g", $NF))n=0;else n=split($NF, a, /,/); print NR,$1,n}
' |
sort -k2,2 -k3,3nr |
awk '$2!=x{x=$2;print $1}' >idx.txt
content of index file
$ cat idx.txt
2
5
select lines
$ awk 'NR==FNR{idx[$0]; next}; (FNR in idx)' idx.txt input.txt
("aborrecimento",[Noun],[Masc],[Reg:Sing],[Device,Concrete,Count])
("adiamento",[Noun],[Masc],[Reg:Sing],[Count])
Note: no space in input.txt
Use [ as the field delimiter, then split the last field on ,:
awk -F '[[]' '
{split($NF, f, /,/)}
length(f) > max[$1] {line[$1] = $0; max[$1] = length(f)}
END {for (l in line) print line[l]}
' filename
Since order is important, an update:
awk -F '[[]' '
{split($NF, f, /,/)}
length(f) > max[$1] {line[$1] = $0; max[$1] = length(f); nr[$1] = NR}
END {for (l in line) printf("%d\t%s\n", nr[$1], line[l])}
' filename |
sort -n |
cut -f 2-
Something like this might work:
awk 'BEGIN {FS="["}
Ff != gensub("^([^,]+).*","\\1","g",$0) { Ff = gensub("^([^,]+).*","\\1","g",$0) ; Lf = $NF ; if (length(Ml) > 0) { print Ml } }
Ff == gensub("^([^,]+).*","\\1","g",$0) { if (length($NF) > length(Lf)) { Lf=$NF ; Ml=$0 } }
END {if (length(Ml) > 0) { print Ml } }' INPUTFILE
See here in action. BUT it's not the solution you want to use, as this is rather a hack. And it fails you if you meant that your last field is longer if it contains more , separated elements than the length of your last element. (E.g. the above script happily reports [KABLAMMMMMMMMMMM!] as longer than [A,B,C].)
This might work for you:
sort -r file | sort -t, -k1,1 -u