I have comma separated file and i need to filter the file based upon some columns values; i am using following command which is giving me required result but i am unable to print all columns using following command.
The following command is giving me all columns avoiding filter; so the target file is same as size as source.
This is the command i am using
awk 'BEGIN{ FS=OFS=","}{ if($7=="\"3YM62AE#UUS\"" && $5=="\"01CS\""){ print $0 }}' file1.csv > file2.csv
in your awk script ignore double quotes. Try something like:
awk 'BEGIN { FS=OFS=","} $7=="3YM62AE#UUS" && $5=="01CS" { print }' file1.csv > file2.csv
Related
I have the following csv file
238013750030646-2;;"Default";"2020-10-01 00:40:36";;"opening";0;3591911;283940640
238013750030646-2;;"Default";"2020-10-03 00:40:36";;"closing line";0;89320;283940640
238013750030646-2;;"something-else";"2020-10-04 00:40:36";;"started";0;0;283940640
238013750030646-2;;"default else";"2020-10-08 05:42:06";;"opening";0;2410;283940640
Im trying to store each line in a specific file matching the date from each line, with the date being in the 4th column of each line, so first line ("2020-10-01 00:40:36") should be in output-01.csv, second line in output-03.csv etc
This awk command
awk -F";|-" -vOFS='\t' '{print > "output-"$7".csv"}' testing.csv
half works but fails on line 3 because of the - in the 3rd column, and line 4 because of the in the 3rd column - this produces output-10.csv
Is there a way to run the awk command twice ? then i could extract the date using the ; separator and then split using -
Using gawk takes care of unsorted file too :
awk 'match($0,/([0-9]{4})-([0-9]{2})-([0-9]{2})/,arr){
file=sprintf("output-%s.csv",arr[3]);
if(!seen[file]++){
print >file;
next
}
}{
print >>file;
close(file);
}' infile
Explanation:
awk 'match($0,/([0-9]{4})-([0-9]{2})-([0-9]{2})/,arr){ # match for regex
file=sprintf("output-%s.csv",arr[3]); # file variable using array arr value, 3rd index
if(!seen[file]++){ # if not seen file name before in array seen
print >file; # print content to file
next # go to next line
}
}{
print >>file; # append content to file
close(file); # close file
}' infile
Try this:
$ awk -F';' -v OFS='\t' '{split($4,a,/[- ]/); file = "output-"a[3]".csv";
$1=$1; print > file; close(file)}' testing.csv
split($4,a,/[- ]/) this will split 4th field further based on space or - characters, saved in array a
file = "output-"a[3]".csv" output filename
$1=$1 since there's no other command changing contents of input line, this is needed to rebuild input line, otherwise OFS will not be applied
print > file print input line to required file
close(file) calling close, useful if there are too many file names
You can also use file = "output-" substr($4,10,2) ".csv" instead of split if the 4th column is consistent as shown in the sample.
With your shown samples, please try following, written and tested in GNU awk.
awk '
match($0,/[0-9]{4}(-[0-9]{2}){2}/){
outputFile=substr($0,RSTART+8,RLENGTH-8)".csv"
print >> (outputFile)
close(outputFile)
}
' Input_file
Explanation: Adding detailed explanation for above.
awk ' ##Starting awk program from here.
match($0,/[0-9]{4}(-[0-9]{2}){2}/){ ##using match function to match yyyy-mm-dd here in line.
outputFile=substr($0,RSTART+8,RLENGTH-8)".csv" ##Getting matched regex sub-string into outputFile here.
print >> (outputFile) ##Printing current line into outputFile here.
close(outputFile) ##Closing output file to avoid too many files opened error.
}
' Input_file ##Mentioning Input_file name here.
To do this efficiently you should sort on the key field first:
awk -F';' '{print $4, NR, $0}' file |
sort -k1,1 -k3,3n |
awk '
{ curr=$1; sub(/([^ ]+ ){2}/,"") }
curr != prev { close(out); out="output-" (++c) ".csv"; prev=curr }
{ print > out }
'
$ head output*.csv
==> output-1.csv <==
238013750030646-2;;"Default";"2020-10-01 00:40:36";;"opening";0;3591911;283940640
==> output-2.csv <==
238013750030646-2;;"Default";"2020-10-03 00:40:36";;"closing line";0;89320;283940640
==> output-3.csv <==
238013750030646-2;;"something-else";"2020-10-04 00:40:36";;"started";0;0;283940640
==> output-4.csv <==
238013750030646-2;;"default else";"2020-10-08 05:42:06";;"opening";0;2410;283940640
The above will work using any awk+sort in any shell on every Unix box. See the many similar examples on this site for an explanation.
I have a csv and for each line in the csv, I need to add new columns. One of the columns is a timestamp and it seems to be breaking the operation.
Example:
col1,col2,col3
1,2,3
4,5,7
After
col1,col2,col3,col4,col5,col6
1,2,3,01-01-2020 01:01:01,name,class
4,5,7,01-01-2020 01:01:01,name,class
I used How to add new column with header to csv with awk
for reference.
ORIG_FILE='sample.csv'
NEW_FILE='new_sample.csv'
values="01-01-2020 01:01:01,name,class"
awk -v d=$values -F"," 'BEGIN {OFS = ","} {printf("%s%s",$0,FNR>1?d RS:"col4,col5,col6" RS)}' $ORIG_FILE > $NEW_FILE
I am very new to using bash and I am trying to figure this out.
Any help greatly appreciated.
orig_file='sample.csv'
new_file='new_sample.csv'
values='01-01-2020 01:01:01,name,class'
awk -v d="$values" 'BEGIN{FS=OFS=","} { print $0, (NR>1 ? d : "col4,col5,col6") }' "$orig_file" > "$new_file"
Always quote your shell variables and don't use all upper case for non-exported shell variable names.
input.txt:
>block1
111111111111111111111
>block2
222222222222222222222
>block3
333333333333333333333
AWK command:
awk '/>block2.*>/' input.txt
Expected output
222222222222222222222
However, AWK is returning nothing. What am I misunderstanding?
Thanks!
If you want to print the line after the line containing >block2, then you could use:
awk '/^>block2$/ { nr=NR+1 } NR == nr { print }'
Track the record number plus 1 when you find the match; when the current record number matches the remembered one, print the current record.
If you want all the lines between the line >block2 and >block3, then you'd use:
awk '/^>block2$/,/^>block3/ {if ($0 !~ /^>block[23]$/) print }'
For all lines between the two markers, if the line doesn't match either marker, print it. The output is the same with the sample data file.
another awk
$ awk 'c&&c--; /^>block2/{c=1}' file
222222222222222222222
c specifies how many lines you want to print after the match. If you want the text between two markers
$ awk '/^>block3/{exit} s; /^>block2/{s=1}' file
222222222222222222222
if there are multiple instances and you want them all, just change exit to s=0
You probably meant:
$ awk '/>/{f=/^>block2$/;next} f' file
222222222222222222222
I have fasta file that contains two gene sequences and what I want to do is remove the fasta header (line starting with ">"), concatenate the rest of the lines and output that sequence
Here is my fasta sequence (genome.fa):
>Potrs164783
AGGAAGTGTGAGATTGAAAAAACATTACTATTGAGGAATTTTTGACCAGATCAGAATTGAACCAACATGATGAAGGGGAT
TGTTTGCCATCAGAATATGGCATGAAATTTCTCCCCTAGATCGGTTCAAGCTCCTGTAGGTTTGGAGTCCTTAGTGAGAA
CTTTCTTAAGAGAATCTAATCTGGTCTGTTCCTCGTCATAAGTTAAAGAAAAACTTGAAACAAATAACAAGCATGCATAA
>Potrs164784
TTACCCTCTACCAGCACCAATGCCTATGATCTTACAAAAATCCTTAATAAAAAGAAATCCAAAACCATTGTTACCATTCC
GGAATTACATTCTGAGATAAAAACCCTCAAATCTGAATTACAATCCCTTAAACAAGCCCAACAAAAAGACTCTGCCATAC
Desired output
AGGAAGTGTGAGATTGAAAAAACATTACTATTGAGGAATTTTTGACCAGATCAGAATTGAACCAACATGATGAAGGGGAT
TGTTTGCCATCAGAATATGGCATGAAATTTCTCCCCTAGATCGGTTCAAGCTCCTGTAGGTTTGGAGTCCTTAGTGAGAA
CTTTCTTAAGAGAATCTAATCTGGTCTGTTCCTCGTCATAAGTTAAAGAAAAACTTGAAACAAATAACAAGCATGCATAA
TTACCCTCTACCAGCACCAATGCCTATGATCTTACAAAAATCCTTAATAAAAAGAAATCCAAAACCATTGTTACCATTCC
GGAATTACATTCTGAGATAAAAACCCTCAAATCTGAATTACAATCCCTTAAACAAGCCCAACAAAAAGACTCTGCCATAC
I am using awk to do this but I am getting this error
awk 'BEGIN{filename="file1"}{if($1 ~ />/){filename=$1; sub(/>/,"",filename); print filename;} print $0 >filename.fa;}' ../genome.fa
awk: syntax error at source line 1
context is
BEGIN{filename="file1"}{if($1 ~ />/){filename=$1; sub(/>/,"",filename); print filename;} print $0 >>> >filename. <<< fa;}
awk: illegal statement at source line 1
I am basically a python person and I was given this script by someone. What am I doing wrong here?
I realized that i was not clear and so i am pasting the whole code that i got from someone. The input file and desired output remains the same
mkdir split_genome;
cd split_genome;
awk 'BEGIN{filename="file1"}{if($1 ~ />/){filename=$1; sub(/>/,"",filename); print filename;} print $0 >filename.fa;}' ../genome.fa;
ls -1 `pwd`/* > ../scaffold_list.txt;
cd ..;
If all you want to do is produce the desired output shown in your question, other solutions will work.
However, the script you have is trying to print each sequence to a file that is named using its header, and the extension .fa.
The syntax error you're getting is because filename.fa is neither a variable or a fixed string. While no Awk will allow you to print to filename.fa because it is neither in quotes or a variable (varaible names can't have a . in them), BSD Awk does not allow manipulating strings when they currently act as a file name where GNU Awk does.
So the solution:
print $0 > filename".fa"
would produce the same error in BSD Awk, but would work in GNU Awk.
To fix this, you can append the extension ".fa" to filename at assignment.
This will do the job:
$ awk '{if($0 ~ /^>/) filename=substr($0, 2)".fa"; else print $0 > filename}' file
$ cat Potrs164783.fa
AGGAAGTGTGAGATTGAAAAAACATTACTATTGAGGAATTTTTGACCAGATCAGAATTGAACCAACATGATGAAGGGGAT
TGTTTGCCATCAGAATATGGCATGAAATTTCTCCCCTAGATCGGTTCAAGCTCCTGTAGGTTTGGAGTCCTTAGTGAGAA
CTTTCTTAAGAGAATCTAATCTGGTCTGTTCCTCGTCATAAGTTAAAGAAAAACTTGAAACAAATAACAAGCATGCATAA
$ cat Potrs164784.fa
TTACCCTCTACCAGCACCAATGCCTATGATCTTACAAAAATCCTTAATAAAAAGAAATCCAAAACCATTGTTACCATTCC
GGAATTACATTCTGAGATAAAAACCCTCAAATCTGAATTACAATCCCTTAAACAAGCCCAACAAAAAGACTCTGCCATAC
You'll notice I left out the BEGIN{filename="file1"} declaration statement as it is unnecessary. Also, I replaced the need for sub(...) by using the string function substr as it is more clear and requires fewer actions.
The awk code that you show attempts to do something different than produce the output that you want. Fortunately, there are much simpler ways to obtain your desired output. For example:
$ grep -v '>' ../genome.fa
AGGAAGTGTGAGATTGAAAAAACATTACTATTGAGGAATTTTTGACCAGATCAGAATTGAACCAACATGATGAAGGGGAT
TGTTTGCCATCAGAATATGGCATGAAATTTCTCCCCTAGATCGGTTCAAGCTCCTGTAGGTTTGGAGTCCTTAGTGAGAA
CTTTCTTAAGAGAATCTAATCTGGTCTGTTCCTCGTCATAAGTTAAAGAAAAACTTGAAACAAATAACAAGCATGCATAA
TTACCCTCTACCAGCACCAATGCCTATGATCTTACAAAAATCCTTAATAAAAAGAAATCCAAAACCATTGTTACCATTCC
GGAATTACATTCTGAGATAAAAACCCTCAAATCTGAATTACAATCCCTTAAACAAGCCCAACAAAAAGACTCTGCCATAC
Alternatively, if you had intended to have all non-header lines concatenated into one line:
$ sed -n '/^>/!H; $!d; x; s/\n//gp' ../genome.fa
AGGAAGTGTGAGATTGAAAAAACATTACTATTGAGGAATTTTTGACCAGATCAGAATTGAACCAACATGATGAAGGGGATTGTTTGCCATCAGAATATGGCATGAAATTTCTCCCCTAGATCGGTTCAAGCTCCTGTAGGTTTGGAGTCCTTAGTGAGAACTTTCTTAAGAGAATCTAATCTGGTCTGTTCCTCGTCATAAGTTAAAGAAAAACTTGAAACAAATAACAAGCATGCATAATTACCCTCTACCAGCACCAATGCCTATGATCTTACAAAAATCCTTAATAAAAAGAAATCCAAAACCATTGTTACCATTCCGGAATTACATTCTGAGATAAAAACCCTCAAATCTGAATTACAATCCCTTAAACAAGCCCAACAAAAAGACTCTGCCATAC
Try this to print lines not started by > and in one line:
awk '!/^>/{printf $0}' genome.fa > filename.fa
With carriage return:
awk '!/^>/' genome.fa > filename.fa
To create single files named by the headers:
awk 'split($0,a,"^>")>1{file=a[2];next}{print >file}' genome.fa
I have a bunch of dns entries in a file
a1.us.company.com ------ DO NOT PRINT
a2.us.us.company.com ------PRINT------ ("us" is repeated)
a3.eu.a3.compamy.com ------PRINT------ ("a3" is repeated)
a4.tx.a4.tx.company.com -----PRINT------- ("a4" and "tx" is repeated)
awk 'BEGIN {FS="."; OFS="."} {if ($2==$3) print $1"."$2"."$NF}' device_list
awk 'BEGIN {FS="."; OFS="."} {if ($1==$3) print $1"."$2"."$NF}' device_list
I am using 2 commands above.
Can someone please give me a awk command that lists duplicate columns per row.
Some of the names are crazy with as many as 7 to 8 . separated fields.
$ cat file
a1.us.company.com
a2.us.us.company.com
a3.eu.a3.compamy.com
a4.tx.a4.tx.company.com
$ awk -F'.' '{delete seen; for (i=1;i<=NF;i++) if (seen[$i]++) {print; next} }' file
a2.us.us.company.com
a3.eu.a3.compamy.com
a4.tx.a4.tx.company.com
Note that using delete seen is GNU-awk specific, with other awks you can delete the whole array by doing split("",seen).
$ awk -F. '{for(i=1;i<=NF;i++)if(x[$i]++){print;delete x;next}}' file
a2.us.us.company.com
a3.eu.a3.compamy.com
a4.tx.a4.tx.company.com
If you want to try this on a Solaris/SunOS system, change awk to /usr/xpg4/bin/awk , /usr/xpg6/bin/awk , or nawk