This question already has answers here:
Read lines from a file into a Bash array [duplicate]
(6 answers)
Closed 6 years ago.
I'm using awk in a shell script to parse a file.
My question has been marked as duplicate of an other, but I want to use awk and I didn't find the same question
Here is the file format:
Hi everyone I'm new\n
Can u help me please\n
to split this file\n
with awk ?\n
The result I hope:
tab[0]=Hi everyone I'm new
tab[1]=Can u help me please
tab[2]=to split this file
tab[3]=with awk ?
So I tried to change FS and RS values to tried get what I wanted but without success. Here what I tried:
config=`cat $1`
tab=($(echo $config | awk '
{
for (i = 1; i < (NF); i++)
print $i;
}'))
And what I get:
Hi
everyone
I'm
new
Can
u
help
me
please
to
split
this
file
with
awk
Do u know how to proceed please ? :/
The problem is that however you parse the file in awk, it's returned to the shell as a simple string.
AWK splits a file into records (line ending in \n), and records are further split into fields (separated by FS, space by default).
In order to assign the returned string to an array, you need to set the shell's IFS to newline, or assign the lines to array items one by one (you can filter the record with NR, which would then require you to read the file several times with AWK).
Your best course of action is to just print the records in AWK and assign them to a bash array using compound assignment, with IFS set to newline character
#/bin/bash
declare -a tab
IFS='
'
# Compount assignment: array=(words)
# Print record: { print } is the same as { print $0 }
# where $0 is the record and $1 ... $N are the fields in the record
tab=($(awk '{ print }' file))
unset IFS
for index in ${!tab[#]}; do
echo "${index}: ${tab[index]}"
done
# Output:
# 0: Hi everyone I'm new
# 1: Can u help me please
# 2: to split this file
# 3: with awk ?
Notice that awk is hardly used at all, and should be replaced with simple cat.
Related
i have file contains urls plus params like following
https://example.com/endpoint/?param1=123¶m2=1212
https://example.com/endpoint/?param3=123¶m1=98989
https://example.com/endpoint/endpoint3/?param2=123
https://example.com/endpoint/endpoint2/?param1=123
https://example.com/endpoint/endpoint2/
https://example.com/endpoint/endpoint5/"//i.example.com/00/s/Nzk5WDEwMjQ=/z/47IAAOSwBu5hXIKF
and i need to filter only urls with unique params
the desired output
http://example.com/endpoint/?param1=123¶m2=1212
https://example.com/endpoint/?param3=123¶m1=98989
https://example.com/endpoint/endpoint3/?param2=123
i managed to filter only urls with params with grep
grep -E '(\?[a-zA-Z0-9]{1,9}\=)'
but i need to filter params in the same time so i tried with awk with the same regex
but it gives error
awk '{sub(\?[a-zA-Z0-9]{1,9}\=)} !seen[$0]++'
update
i am sorry for editing the desired output but when i tried the scripts i figured out that their a lot of carbege in my file need to filter too.
i tried #James Brown with some editing and it looks good till the end line it dose not filter it unfortunately
awk -F '?|&' '$2&&!a[$2]++'
and to be more clear why the that output is good for me
it chosed the 1 st line because it has at least param1
2nd line because it has at least param3
3 line because it has at least param2
the comparison method here is choose just unique parameter whatever it concatenate with others with & char or not
Edited version after the reqs changes some:
$ awk -F? '{ # ? as field delimiter
split($2,b,/&/) # split at & to get whats between ? and &
if(b[1]!=""&&!a[b[1]]++) # no ? means no $2
print
}' file
Output as expected. Original answer was:
A short one:
$ awk -F? '$2&&!a[$2]++' file
Explained: Split records at ? (-F?) and if there is a second field ($2) and (&&) it is unique this far by counting the instances of the parameters in the array a (!a[$2]++), output it.
EDIT: Following solution may help when query string has ? as well as & present in it and we want to consider both of them for removing duplicates.
awk '
/\?/{
match($0,/\?[^&]*/)
val=substr($0,RSTART,RLENGTH)
match($0,/&.*/)
if(!seen[val]++ && !seen[substr($0,RSTART,RLENGTH)]++){
print
}
}' Input_file
2nd solution: (Following solution may help when we don't have & parameters in query string) With your shown samples, please try following awk program.
awk 'match($0,/\?.*$/) && !seen[substr($0,RSTART,RLENGTH)]++' Input_file
OR above could be shorten to as follows:(as per Ed sir's suggestions):
awk 's=index($0,"?") && !seen[substr($0,s)]++' Input_file
Explanation: Simple explanation would be, using match function of awk which matches everything from ? to till end of line value. Then adding an AND condition to it to make sure we get only unique values out of all matched values in all lines.
With gnu awk, you could also match the url till the first occurrence of the question mark, and then capture what follows using your initial pattern for the first parameter ([a-zA-Z0-9]{1,9}=[^&]+) followed by matching any character except the &
Then you can use the !seen[$0]++ part with the value of capture group 1.
awk '
match($0, /https?:\/\/[^?]+\?([a-zA-Z0-9]{1,9}=[^&]+)/, arr) && !seen[arr[1]]++
' file
Output
https://example.com/endpoint/?param1=123¶m2=1212
https://example.com/endpoint/?param3=123¶m1=98989
https://example.com/endpoint/endpoint3/?param2=123
Using awk you can check that the string starts with the protocol and contains a question mark.
Then to get the first parameter only, you can split on ? and & and use the second part of the split for seen
awk '
/^https?:\/\/[^?]*\?/ && split($0, arr, /[?&]/) > 1 && !seen[arr[2]]++
' file
This question already has answers here:
How to remove the lines which appear on file B from another file A?
(12 answers)
Closed 1 year ago.
I have the following for getting the lines matching a variable using awk:
for i in `cat file1`; do awk -v id="$i" '$0 ~ id' file2; done
How can I do the opposite?
Getting the lines that DON'T match? I think I should use ! somewhere, but don't know where.
File 1 looks like this:
5NX1D
5NX3D
4NTYB
File 2 looks like this:
2R9PA IVGGYTCEENS
2RA3C RPDFCLEPPYT
6HARE YVDYKDDDDKE
4NTYB EYVDYKDDDDD
Output should look like this:
2R9PA IVGGYTCEENS
2RA3C RPDFCLEPPYT
6HARE YVDYKDDDDKE
This is the standard inner join, except we print if a match was not found.
awk 'NR==FNR { a[$1]; next }
!($1 in a)' file1 file2 >newfile2
This is very standard Awk idiom all the way, but very briefly, the line number within the current file FNR will be equal to the overall input line number NR while we are traversing the first input file, file1. If so, we add its contents to the array a, and skip to the next line. Else, if we fall through, we are no longer in the first file; we print if the first field $1 is not in a.
Your original script would be more idiomatic and a lot more efficient phrased similarly (just without the !), too.
I am trying to filter all the singleton from a fasta file.
Here is my input file:
>OTU1;size=3;
ATTCCCCGGGGGGG
>OTU2;size=1;
ATCCGGGACTGATC
>OTU3;size=5;
GAACTATCGGGTAA
>OTU4;size=1;
AATTGGCCATCT
The expected output is:
>OTU1;size=3;
ATTCCCCGGGGGGG
>OTU3;size=5;
GAACTATCGGGTAA
I've tried
awk -F'>' '{if($1>=2) {print $0}' input.fasta > ouput.fasta
but this will remove all the header for each OTU.
Anyone could help me out?
Could you please try following.
awk -F'[=;]' '/^>/{flag=""} $3>=3{flag=1} flag' Input_file
$ awk '/>/{f=/=1;/}!f' file
>OTU1;size=3;
ATTCCCCGGGGGGG
>OTU3;size=5;
GAACTATCGGGTAA
awk -v FS='[;=]' 'prev_sz>=2 && !/size/{print prev RS $0} /size/{prev=$0;prev_sz=$(NF-1)}'
>OTU1;size=3;
ATTCCCCGGGGGGG
>OTU3;size=5;
GAACTATCGGGTAA
Store the size from each line in prev_sz variable and whole line in prev variables. Now check if its >= 2, then print the previous line and the current line. RS is used to print new line.
While all the above methods work, they are limited to the fact that input always has to look the same. I.e the sequence-name in your fasta-file needs to have the form:
>NAME;size=value;
A few solutions can handle a bit more extended sequence-names, but none handle the case where things go a bit more generic, i.e.
>NAME;label1=value1;label2=value2;STRING;label3=value3;
Print sequence where label xxx matches value vvv:
awk '/>{f = /;xxx=vvv;/}f' file.fasta
Print sequence where label xxx has a numeric value p bigger than q:
awk -v label="xxx" -v limit=q \
'BEGIN{ere=";" label "="}
/>/{ f=0; match($0,ere);value=0+substr($0,RSTART+length(ere)); f=(value>limit)}
f' <file>
In the above ere is a regular expression we try to match. We use it to find the location of the value attached to label xxx. This substring will have none-numeric characters after its value, but by adding 0 to it, it is converted to a number, losing all non-numeric values (i.e. 3;label4=value4; is converted to 3). We check if the value is bigger than our limit, and print the sequence based on that result.
This question already has answers here:
get the user input in awk
(3 answers)
Closed 6 years ago.
I'm trying to take a user input in a pure [g]awk code. now the requirement is that I want the user to enter either today or current - number of days to generate a report. I can't find any routine inside the awk to read user's input. sometime back I had read a document on awk where it was done using either sprintf or printf, but I dont know how.
OR
in awk, I'm using BEGIN block to setup a variable and then search based on that, but not finding it quite helpful to search the variable based search. something like below:
awk -F "|" ' BEGIN { PWR="Nov 3"; }
/Deployment started at PWR/ { print $1 + $NF }' /var/log/deployments
this offensively denies me any search for the pattern of "Deployment started at Nov 3".
Inside the regex slashes, you don't have access to your variables. What you can do is make a string out of the search phrase then apply that string as a regex.
awk -F "|" ' BEGIN { PWR="Nov 3"; }
$0 ~ "Deployment started at "PWR { print $1 + $NF }' /var/log/deployments
I am trying to work with an AWK script that was posted earlier on this forum. I am trying to split a large FASTA file containing multiple DNA sequences, into separate FASTA files. I need to separate each sequence into its own FASTA file, and the name of each of the new FASTA files needs to be the name of the DNA sequence from the original, large multifasta file (all the characters after the >).
I tried this script that I found here at stackoverflow:
awk '/^>chr/ {OUT=substr($0,2) ".fa"}; OUT {print >OUT}' your_input
It works well, but the DNA sequence begins directly after the name of the file- with no space. The DNA sequence needs to begin on a new line (regular FASTA format).
I would appreciate any help to solve this.
Thank you!!
Do you mean something like this?
awk '/^>chr/ {OUT=substr($0,2) ".fa";print " ">OUT}; OUT{print >OUT}' your_input
where the new file that is created for each "chromosome/sequence/thing" gets a blank line at the start?
I think this should work.
awk '/^>chr/ {OUT=substr($0,2) ".fa"}; {print >> OUT; close(OUT)}' Input_File
Hope this perl script could help.
#!/usr/bin/perl
open (INFILE, "< your_input.fa")
or die "Can't open file";
while (<INFILE>) {
$line = $_;
chomp $line;
if ($line =~ /\>/) { #if has fasta >
close OUTFILE;
$new_file = substr($line,1);
$new_file .= ".fa";
open (OUTFILE, ">$new_file")
or die "Can't open: $new_file $!";
}
print OUTFILE "$line\n";
}
close OUTFILE;
The .fa (or .fasta) format looks like:
>ID1
SEQUENCE
>ID2
SEQUENCE
When splitting a fasta file it is actually not desired inserting a new line character at its top. Therefore the answer of Pramod is more appropriate. Additionally, the ID can be defined more generally to match only the > character. Consequently, the complete line would be:
awk '/^>/ {OUT=substr($0,2) ".fa"}; {print >> OUT; close(OUT)}' Input_File
If you don't want to mess up your current directory with all the split files you can also output into a subdirectory (subdir):
awk '/^>/ {OUT="subdir/" substr($0,2) ".fa"}; {print >> OUT; close(OUT)}' Input_File
awk to split multi-sequence fasta file into separate sequence files
This problem is best approached by considering each sequence (complete with header) a single record and changing awk's default record separator RS (usually a line break) to be the unique (one per record) > symbol used to define the start of a header. As we will want to use the header text as a file name, and as fasta headers cannot contain line-breaks, it is also convenient to reset awk's default field separaor FS (usually white space) to be line breaks.
Both of these are done in an awk BEGIN block:
BEGIN{RS=">";FS="\n"}
Since the file begins with >, the first record will be empty and therefore must be ignored to prevent an error caused by trying to write to a file name extracted from an empty record. Thus, the main awk action block is filtered to only process records beginning with record number (NR) 2. This is achieved by placing a condition before the action block as follows:
NR>1{ ... }
with the record separator set to > each record is a whole sequence including its header, and each is split into fields at line breaks (because we set the field separator to "\n"). Thus, field 1 ($1) of each record contains the text we wish to use as filenames. Note the record separator (>) is no longer part of any field and so the entire first field can be used to build the filename. In this example, ".fasta" has been appended as a file extension:
fnme=$1 ".fasta";
Next, the fasta header marker ">" is printed, followed by the entire record ($0) to the filename fnme just formed, using awk's > redirect:
print ">" $0 > fnme;
lastly, the file is closed to prevent awk exceeding the system limit for the number of open files allowed, if many files are to be written (see footnote):
close(fnme);
whole procedure
awk command
awk 'BEGIN{RS=">";FS="\n"} NR>1{fnme=$1".fasta"; print ">" $0 > fnme; close(fnme);}' example.fasta
Tested on the following mock file named example.fasta:
>DNA sequence 1
GCAAAAGAACCGCCGCCACTGGTCGTGAAAGTGGTCGATCCAGTGACATCCCAGGTGTTGTTAAATTGAT
CATGGGCAGTGGCGGTGTAGGCTTGAGTACTGGCTACAACAACACTCGCACTACCCGGAGTGATAGTAAT
GCCGGTGGCGGTACCATGTACGGTGGTGAAGT
>DNA sequence 2
TCCCAGCCAGCAGGTAGGGTCAAAACATGCAAGCCGGTGGCGATTCCGCCGACAGCATTCTCTGTAATTA
ATTGCTACCAGCGCGATTGGCGCCGCGACCAGGATCCTTTTTAACCATTTCAGAAAACCATTTGAGTCCA
TTTGAACCTCCATCTTTGTTC
>DNA sequence 3
AACAAAAGAATTAGAGATATTTAACTCCACATTATTAAACTTGTCAATAACTATTTTTAACTTACCAGAA
AATTTCAGAATCGTTGCGAAAAATCTTGGGTATATTCAACACTGCCTGTATAACGAAACACAATAGTACT
TTAGGCTAACTAAGAAAAAACTTT
results (terminal commands and output)
$ ls
'DNA sequence 1.fasta' 'DNA sequence 3.fasta'
'DNA sequence 2.fasta' example.fasta
$ cat DNA\ sequence\ 1.fasta
>DNA sequence 1
GCAAAAGAACCGCCGCCACTGGTCGTGAAAGTGGTCGATCCAGTGACATCCCAGGTGTTGTTAAATTGAT
CATGGGCAGTGGCGGTGTAGGCTTGAGTACTGGCTACAACAACACTCGCACTACCCGGAGTGATAGTAAT
GCCGGTGGCGGTACCATGTACGGTGGTGAAGT
$ cat DNA\ sequence\ 2.fasta
>DNA sequence 2
TCCCAGCCAGCAGGTAGGGTCAAAACATGCAAGCCGGTGGCGATTCCGCCGACAGCATTCTCTGTAATTA
ATTGCTACCAGCGCGATTGGCGCCGCGACCAGGATCCTTTTTAACCATTTCAGAAAACCATTTGAGTCCA
TTTGAACCTCCATCTTTGTTC
$ cat DNA\ sequence\ 3.fasta
>DNA sequence 3
AACAAAAGAATTAGAGATATTTAACTCCACATTATTAAACTTGTCAATAACTATTTTTAACTTACCAGAA
AATTTCAGAATCGTTGCGAAAAATCTTGGGTATATTCAACACTGCCTGTATAACGAAACACAATAGTACT
TTAGGCTAACTAAGAAAAAACTTT
footnote
"To write numerous files, successively, in the same awk program. If the files aren’t closed, eventually awk may exceed a system limit on the number of open files in one process. It is best to close each one when the program has finished writing it."
quoted from https://www.gnu.org/software/gawk/manual/html_node/Close-Files-And-Pipes.html